ID: 1060357045

View in Genome Browser
Species Human (GRCh38)
Location 9:122918940-122918962
Sequence CCTTTCCAGTGTAAAATCTG TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 253
Summary {0: 1, 1: 0, 2: 6, 3: 25, 4: 221}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060357045_1060357049 14 Left 1060357045 9:122918940-122918962 CCACAGATTTTACACTGGAAAGG 0: 1
1: 0
2: 6
3: 25
4: 221
Right 1060357049 9:122918977-122918999 GCACACGCATGTGTCGATGAAGG 0: 1
1: 0
2: 0
3: 1
4: 32

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060357045 Original CRISPR CCTTTCCAGTGTAAAATCTG TGG (reversed) Exonic
900082585 1:869792-869814 CCTTACTAGTGAAAAAGCTGGGG - Intergenic
900791633 1:4684587-4684609 CCTTTCCTGGGTAGAATCTTGGG + Intronic
906648076 1:47490457-47490479 CCTCTCCAGTGTTGAATGTGAGG + Intergenic
908372301 1:63495437-63495459 GCTTTCCAATGTTAAGTCTGCGG - Intronic
908393252 1:63702598-63702620 CCTTTCCAAGGTATAATATGTGG + Intergenic
908721360 1:67129543-67129565 CCTTCCCAGTGTGCAACCTGAGG - Intronic
910847184 1:91614925-91614947 TCTTTCCTGTGTGAAATCTGTGG - Intergenic
911630654 1:100180174-100180196 CCTTTCCAAGGTAGAATTTGAGG + Intergenic
912038871 1:105359025-105359047 CCTTTCCAGTTTTAAACATGAGG - Intergenic
913176560 1:116278045-116278067 CAGTTCCAGTGTCAAATCCGAGG - Intergenic
913272084 1:117104250-117104272 CCTTTCATCTGTAAAATGTGTGG + Exonic
916931114 1:169578924-169578946 CCTTTCCAATAGAAAATGTGGGG - Intronic
918880694 1:190116055-190116077 CCTGTGTAGTGTAAAATCAGAGG + Intronic
921587208 1:216961918-216961940 CCTTTAAAGTGAATAATCTGTGG - Intronic
921963968 1:221067824-221067846 CTTTTACAGTGTAGACTCTGAGG + Intergenic
924737470 1:246771106-246771128 CCTTTTCAGTGTAGAGTCTGCGG - Intergenic
924768152 1:247053298-247053320 ACTTTCCTGGGCAAAATCTGGGG - Intronic
1062760047 10:11329-11351 CCTTACTAGTGAAAAAGCTGGGG - Intergenic
1062966748 10:1613147-1613169 CGTCTCCAGAGTAAGATCTGTGG + Intronic
1063931507 10:11033119-11033141 CCTCTACAGTGAAAATTCTGAGG + Intronic
1064221617 10:13445684-13445706 CGTTTCCAGTGAGAAAACTGAGG - Intronic
1065459278 10:25939421-25939443 CCTTTCTAATGTAAAATTTGAGG + Intronic
1066747606 10:38616382-38616404 CCTTACTAGTGAAAAAGCTGGGG - Intergenic
1068577949 10:58706103-58706125 CCTTTACATTGAAAAATTTGAGG + Intronic
1069551313 10:69366427-69366449 CCTTACATCTGTAAAATCTGTGG + Intronic
1070424544 10:76272626-76272648 CTTTTCCAATGTATATTCTGGGG - Intronic
1070654170 10:78259748-78259770 CCCATCCAGTAGAAAATCTGGGG - Intergenic
1071992865 10:91116868-91116890 CGTTCCCAGTGTTAAAGCTGTGG - Intergenic
1072348940 10:94538992-94539014 CCACTACAGTGTAAACTCTGAGG + Intronic
1072681475 10:97510273-97510295 CCTTTGATTTGTAAAATCTGAGG + Intronic
1074182162 10:111075238-111075260 CCTTTCCAGTGTTAGTTCTGAGG - Intergenic
1075502865 10:122993847-122993869 CCTTTTCAGTGTAATATATGTGG - Exonic
1078265631 11:9754451-9754473 CCTCTGCACTGTAAAAGCTGAGG - Intergenic
1079223767 11:18587889-18587911 AGTTTCCGGTGTACAATCTGAGG - Intronic
1080315111 11:30938811-30938833 CCTTCCCAGTGAATTATCTGTGG + Intronic
1082165600 11:48946673-48946695 GCATGCTAGTGTAAAATCTGTGG - Intergenic
1083651200 11:64205899-64205921 CCTTTCCAGTGAACACACTGGGG - Intergenic
1084087374 11:66860756-66860778 CGTATCCAGTGTAAAGCCTGGGG + Intronic
1084496359 11:69505950-69505972 CATTTCCAGTGTAAATTCGGTGG + Intergenic
1084521347 11:69664937-69664959 CATTCCCAGTGTAAAAGCTGAGG + Intronic
1085068433 11:73519423-73519445 CCTCTAGAGTGTAAACTCTGAGG - Intronic
1086982270 11:93211333-93211355 CCTGTCCATTGTAAAATGTGGGG - Intergenic
1088554170 11:111044883-111044905 CCTTTTCATTGTATCATCTGTGG + Intergenic
1088631457 11:111777750-111777772 CCTTGCCAGTGAAATATTTGTGG - Intergenic
1088895521 11:114075392-114075414 CCTTTCAAGTATACAACCTGAGG - Intronic
1089044957 11:115492767-115492789 CAATTCCAGTCTAACATCTGAGG - Intronic
1090810626 11:130238497-130238519 CCTTTTCAGTGTCCAACCTGCGG - Exonic
1093381047 12:18493658-18493680 CCTTTCCAGTGTGAACCCTCTGG - Intronic
1094807595 12:34107756-34107778 CCTTACTAGTGAAAAAGCTGGGG - Intergenic
1096392347 12:51239112-51239134 CCTTTCCTCCGTAAACTCTGTGG + Intronic
1096718520 12:53505029-53505051 CCTTTCCAGTTGACATTCTGGGG + Intronic
1097023236 12:56035242-56035264 CCTTTTGAGTGCAACATCTGTGG + Exonic
1097971030 12:65633452-65633474 CATTTCCAGTGTAAAGGCTGGGG + Intergenic
1098468265 12:70813952-70813974 CCATTCCTGTGTGAACTCTGAGG - Intronic
1099209828 12:79770827-79770849 CTTTTCCAGTGAAAAATGTGTGG - Intergenic
1101904605 12:108815252-108815274 ACTGTCATGTGTAAAATCTGAGG + Intronic
1103295735 12:119885251-119885273 CTTTTCGAGAGTAAAATTTGTGG + Intergenic
1107005352 13:35603501-35603523 TCTTTCCTGTATAAAATATGTGG - Intronic
1108020122 13:46119828-46119850 ACTTTTAAGTGTTAAATCTGAGG - Intergenic
1109172426 13:59113565-59113587 CCTTACCAGTGCAAACTCTGTGG - Intergenic
1109339103 13:61031412-61031434 TATTTCCAGTGTCAACTCTGAGG - Intergenic
1110732318 13:78893392-78893414 CCCTTCCAGGATAAAGTCTGAGG - Intergenic
1114811236 14:25902407-25902429 CCTTCCCAGTGTAAAGTAAGAGG - Intergenic
1114827312 14:26096800-26096822 CATTTCCTGTATGAAATCTGTGG + Intergenic
1115073788 14:29360769-29360791 CATTTCCAGCTTAAAATATGTGG + Intergenic
1115327919 14:32163642-32163664 ACTTTCCAATGTGAACTCTGAGG + Intergenic
1116085684 14:40235195-40235217 CTTTTCCACTGAAAAGTCTGTGG + Intergenic
1119081917 14:71702698-71702720 CCTTTCCAGTTTTGAATTTGGGG - Intronic
1122417183 14:101556025-101556047 CCTCTCCAGTGAAGAAACTGAGG + Intergenic
1124108138 15:26760423-26760445 CCTCTGCAGTAGAAAATCTGAGG - Intronic
1126719545 15:51562874-51562896 CCTTCCCACTGTAGAAGCTGAGG - Intronic
1129888813 15:79057494-79057516 CCTCCTCAGTGCAAAATCTGTGG + Intronic
1130831822 15:87608705-87608727 ACTTTATAGTGGAAAATCTGAGG + Intergenic
1131324168 15:91426568-91426590 CCTTTCCAGTTAAATAACTGAGG - Intergenic
1132270981 15:100525304-100525326 CCTGCCCACTGGAAAATCTGTGG - Intronic
1133553242 16:6879774-6879796 CCATTCCAATGTCAAATCAGAGG - Intronic
1133578210 16:7115593-7115615 CCTTTCCAGAGGTAAATCTGTGG - Intronic
1133878141 16:9754444-9754466 CCTTCCCAGTGAAAAATTTGGGG + Intronic
1134219484 16:12342512-12342534 TCTTTCCATTGTAATGTCTGTGG + Intronic
1135167968 16:20157181-20157203 CCATTCCAATGTAAGATCTGTGG + Intergenic
1136171464 16:28492202-28492224 CCGCTCCAGTTTAAAACCTGCGG - Exonic
1136564250 16:31060745-31060767 CCCTTCTAGTTTCAAATCTGTGG + Intergenic
1136735201 16:32461204-32461226 CCTTACTAGTGAAAAAGCTGGGG + Intergenic
1136934538 16:34447513-34447535 CCTTTCCAGAGTAAAATCTTAGG - Intergenic
1136970034 16:34964301-34964323 CCTTTCCAGAGTAAAATCTTAGG + Intergenic
1137786231 16:51140003-51140025 CCCTTTAAGTGTAAGATCTGTGG - Exonic
1137786379 16:51140774-51140796 CCATTCAAGTGCAACATCTGCGG - Exonic
1138718733 16:59053772-59053794 CCTCTCCAGTATAAAGGCTGTGG + Intergenic
1138719522 16:59063036-59063058 CCTTTCATTTGTATAATCTGTGG - Intergenic
1139253298 16:65517374-65517396 ACTTTACTGTGTAAAATTTGGGG + Intergenic
1140794553 16:78424947-78424969 CCTTTCAAGTGAATCATCTGGGG + Exonic
1142297319 16:89234000-89234022 CCTTTCCTGTGAAAACCCTGTGG + Exonic
1203017878 16_KI270728v1_random:368388-368410 CCTTACTAGTGAAAAAGCTGGGG - Intergenic
1203036213 16_KI270728v1_random:641546-641568 CCTTACTAGTGAAAAAGCTGGGG - Intergenic
1143627660 17:8120491-8120513 CATTTCCAGTCTAAAAGATGTGG - Intergenic
1147342934 17:39765863-39765885 CCTTTCGAGTGTAACATGTGTGG - Exonic
1149343439 17:55710399-55710421 CCTTTCCTGTGTAAAATAAGAGG - Intergenic
1151438983 17:74115989-74116011 CCTTTCCAGAGACAAAGCTGAGG - Intergenic
1152049333 17:77959597-77959619 CATCACCAGTGCAAAATCTGCGG - Intergenic
1152952955 18:11682-11704 CCTTACTAGTGAAAAAGCTGGGG - Intergenic
1156523696 18:37745973-37745995 TGTTTTCAGTGTGAAATCTGAGG - Intergenic
1157247904 18:46070453-46070475 CCTTGCCAGTGCTAAAACTGTGG + Intronic
1158359968 18:56660954-56660976 CATTTCCATTTTAAACTCTGAGG - Intronic
1160454920 18:78993330-78993352 CCCTTCAAGTGCAACATCTGCGG + Exonic
1160455097 18:78994107-78994129 CCGTTCAAGTGCAAGATCTGCGG + Exonic
1161116653 19:2500844-2500866 TCTTTCCACTGTAAACCCTGTGG + Intergenic
1164009155 19:21182910-21182932 CCTTTCAAATGTAAAAAATGTGG + Exonic
1164028980 19:21383153-21383175 CCTTTCAAATGTAAAAAATGTGG + Intergenic
1164032746 19:21423200-21423222 CCTTTCAAATGTAAAAAATGTGG + Exonic
1164045557 19:21536567-21536589 CCTTTCCAGTGTAAAAAATGTGG + Exonic
1166628874 19:44387532-44387554 CCTTTCCCATGTAATAACTGTGG - Exonic
1167835581 19:52065990-52066012 CCTTTCCAGTGTAACGAATGCGG - Exonic
1167968187 19:53165855-53165877 CCTTACCAGTGTAATAAGTGTGG - Exonic
1168016442 19:53577368-53577390 CCTTACGAGTGTAAAGACTGTGG + Exonic
1168344793 19:55644911-55644933 CCCTTCGAGTGTGACATCTGTGG + Exonic
1168644995 19:58053959-58053981 CCCTTCCAGTGTAGCGTCTGCGG + Exonic
925786531 2:7436557-7436579 CCTTTCCACTGTAAAATGAGAGG - Intergenic
926653982 2:15379054-15379076 CCTTTCTAGTGTTAAATAAGAGG + Intronic
926897976 2:17715660-17715682 TCTTCCAACTGTAAAATCTGTGG - Intronic
929217768 2:39434588-39434610 CATTTCCAGTGGAGAAACTGAGG - Intronic
930078810 2:47430677-47430699 CCTTTGTTGTGTAAAGTCTGTGG + Intronic
930376974 2:50580064-50580086 ACTAGCCAGTCTAAAATCTGAGG - Intronic
932175166 2:69594127-69594149 CCTTCCCAAAGAAAAATCTGGGG - Intronic
932217020 2:69972987-69973009 TCTTTCCAGAGTCAAATCTCTGG + Intergenic
933995959 2:87670003-87670025 CTCTGCCAGTGTAAATTCTGGGG + Intergenic
934310570 2:91858519-91858541 CCTTACTAGTGAAAAAGCTGGGG - Intergenic
935501203 2:103841834-103841856 ACTCTCAACTGTAAAATCTGAGG - Intergenic
936297898 2:111280909-111280931 CTCTGCCAGTGTAAATTCTGGGG - Intergenic
936453437 2:112651297-112651319 CAATTCCAGTGGAAAATCTTGGG - Intronic
937091759 2:119211177-119211199 CATTTCCAGTGAACAATCGGGGG - Intergenic
938496815 2:131802061-131802083 CCTTACTAGTGAAAAAGCTGGGG + Intergenic
943490389 2:188547149-188547171 CCATTCCAGTGAAAAATAAGAGG + Intronic
946672771 2:222123978-222124000 CCATTCCAGTGTAAAATGTGTGG - Intergenic
1169557368 20:6765818-6765840 CCTTGTCAGTTTAGAATCTGAGG - Intergenic
1170675464 20:18476120-18476142 CTTTTAAAGTGTAAAATCTTTGG + Intronic
1170959343 20:21011274-21011296 CTTTTCCAGTGTAGAGTTTGGGG - Intergenic
1172178032 20:32984454-32984476 CCTATCTAGTGTAAAAAGTGGGG + Intronic
1173152563 20:40580438-40580460 CCTTTCAGATGTCAAATCTGAGG - Intergenic
1173655213 20:44695565-44695587 CCTTTCAGGTTTGAAATCTGTGG + Intergenic
1174531587 20:51218803-51218825 GCTTTTCAGTGTACATTCTGGGG - Intergenic
1174609931 20:51790684-51790706 CCGTTCCAGTGTAAGATCTGTGG - Exonic
1175684292 20:61016113-61016135 CCTCTTCAGTGGAAAAGCTGGGG - Intergenic
1177185557 21:17790338-17790360 CCTTACCAGTGTAAACACTAAGG + Exonic
1180537319 22:16404459-16404481 CCTTACCAGTGAAAAAGCTGGGG - Intergenic
1181776969 22:25166733-25166755 TTTTTCCAGTGTGAAAACTGAGG + Intronic
1183713122 22:39518283-39518305 CCTTTTCAGTGTCAAAATTGGGG + Intergenic
949407523 3:3730446-3730468 CCTTTCCAATGTACAAGCAGTGG - Intronic
949662746 3:6299394-6299416 CCTTTACAATGTCAAATATGAGG + Intergenic
949918423 3:8983189-8983211 CCTAGCCAGTGTCAAATCTTGGG + Exonic
949938274 3:9134383-9134405 CCTTCCCAGTGTAAATTTTTAGG + Intronic
950172216 3:10846786-10846808 CCTTACCAGTGGAGAACCTGGGG + Intronic
951691136 3:25397392-25397414 GCTTGCCACTGTAAACTCTGTGG - Intronic
953573768 3:44096166-44096188 CCATGCCAGTGAAAAATCTGTGG - Intergenic
955679808 3:61488620-61488642 CTTTTCCAGTGAGAAAACTGAGG + Intergenic
959738931 3:109693743-109693765 GCTTTCCAGTGTCAGATGTGTGG + Intergenic
959765239 3:110018969-110018991 CCTTTCAAGTATGAAATATGGGG - Intergenic
960464082 3:117974069-117974091 CATCCCCAGTCTAAAATCTGTGG - Intergenic
961972789 3:130988332-130988354 CCTTTTCAGTGTCACATTTGTGG - Intronic
963046901 3:141109366-141109388 CCTTTCCACTGTAAGATGAGGGG - Intronic
968216515 3:196896232-196896254 CCTTTCCTTTTTAATATCTGTGG - Intronic
968684072 4:1944542-1944564 GCTCTCCAGTGTAAAACTTGAGG + Intronic
972817835 4:42663633-42663655 CATTTCCAGTTTCCAATCTGAGG - Intergenic
974430117 4:61785831-61785853 CATTTCCAGAGTAAAAACTTTGG + Intronic
975569291 4:75796668-75796690 CTTTTATCGTGTAAAATCTGTGG + Intronic
978619686 4:110626213-110626235 ACTGTCCAGTGAAAACTCTGTGG + Intronic
981545846 4:145892370-145892392 CCTTTCCAGTGTCCAATATGTGG - Exonic
981918640 4:150062347-150062369 CCTTTTCCGTTTAAAATATGAGG - Intergenic
982390803 4:154862197-154862219 ACATTTCAGTGTGAAATCTGGGG + Intergenic
983926205 4:173405446-173405468 CCTTTCCATAGTACACTCTGTGG + Intronic
984932710 4:184861205-184861227 ACTTTCAAGTGTAAATTCAGTGG + Intergenic
986811890 5:11368609-11368631 CCTTTCATGTGTAGAATTTGAGG - Intronic
988641229 5:33042234-33042256 CCTTTCCAGTGGACCAACTGTGG - Intergenic
990637916 5:57750270-57750292 GCTTTACAGTGGAAAACCTGGGG + Intergenic
991730796 5:69585676-69585698 CCTGTTGAATGTAAAATCTGTGG + Exonic
991807232 5:70440838-70440860 CCTGTTGAATGTAAAATCTGTGG + Intergenic
991864154 5:71042180-71042202 CCTGTTGAGTGTAAAATCTGTGG - Exonic
992520026 5:77540956-77540978 CCCTACCAGTACAAAATCTGAGG + Intronic
993633473 5:90315887-90315909 CCTTGACAGTGTAAAAACTGAGG - Intergenic
993848751 5:92979074-92979096 CCTTTCTATTGTAAAAGGTGTGG - Intergenic
994842156 5:104938696-104938718 CCTTTCCTGTGTAAAATCACAGG - Intergenic
995424598 5:112006087-112006109 CTCTTCCATTGTAAAATCTTAGG - Intergenic
995835950 5:116399752-116399774 CCTTGGCAGTGTAAAATGTAGGG - Intronic
995927544 5:117393223-117393245 CTTTTCCAGTTTAATATCTTTGG - Intergenic
995949903 5:117698737-117698759 CCTTTTCAGCTTAGAATCTGTGG - Intergenic
996763859 5:127015615-127015637 CCCTTCCAAACTAAAATCTGAGG + Intronic
998997990 5:147887620-147887642 CCTTTACACTGTGAAATCTATGG - Intronic
999260571 5:150236051-150236073 CCTTTCCAGAGGGAAATTTGAGG - Intronic
1001321537 5:170686542-170686564 CCTTTGCAGTGTAAAGTCTCTGG - Intronic
1001399673 5:171439089-171439111 CCTTTACAGAGGCAAATCTGAGG - Intronic
1005472190 6:26172178-26172200 CCTTTACAGTTTAAAAACAGAGG + Intergenic
1007413313 6:41677805-41677827 CCTTTCCATTGTACTATCTTTGG - Intergenic
1008964702 6:57302692-57302714 CCTTTCGAGTGTTTATTCTGTGG - Intergenic
1010168759 6:72949787-72949809 GCTTTCCAGTGTAATTTTTGTGG - Intronic
1011783401 6:90816296-90816318 ATTTTCCAGTGTAAAACCAGAGG + Intergenic
1013364672 6:109427709-109427731 CCTTTCCAGAGTGAAAGCTCTGG + Intronic
1014284816 6:119485124-119485146 CCTTTTTAGTGTATAATTTGAGG + Intergenic
1014573116 6:123036066-123036088 CAATTCCATTGTAAAATTTGAGG + Intronic
1016156564 6:140817375-140817397 CCTTTCAAGTAAAAACTCTGTGG - Intergenic
1018557656 6:165065310-165065332 CCTTCCCAGTGGACTATCTGGGG + Intergenic
1019018093 6:168894910-168894932 ACTTACCAGTGCAAAATATGAGG + Intergenic
1021512083 7:21444451-21444473 CCTTTCAGGTATAAAAACTGAGG + Intronic
1023441541 7:40189877-40189899 CATTTACAAGGTAAAATCTGAGG - Intronic
1023714661 7:43030882-43030904 CCTTTCCCCTCTAAACTCTGTGG - Intergenic
1025867484 7:65398628-65398650 CCTTTCAAATGTAAAAACCGTGG + Exonic
1026082924 7:67238299-67238321 TCTTTCCAGTTTAAAATTGGTGG + Exonic
1026457344 7:70584257-70584279 CTTTCCCAGGGTGAAATCTGGGG + Intronic
1026694134 7:72575706-72575728 TCTTTCCAGTTTAAAATTGGTGG - Exonic
1027703391 7:81497568-81497590 CCATTCTAGTGGAATATCTGGGG + Intergenic
1028169034 7:87573572-87573594 GCTTTCAAATATAAAATCTGGGG - Intronic
1028194644 7:87891926-87891948 AATATCCAGTGTAAAATGTGTGG - Intronic
1029288928 7:99486892-99486914 CCTTTTGAGTGTAAGGTCTGTGG + Exonic
1029294831 7:99531875-99531897 CCTTATCAGTGTGATATCTGTGG + Exonic
1030392913 7:108949255-108949277 CCTTTCAAGTGTAATATTAGTGG - Intergenic
1031517081 7:122714422-122714444 CATTTCCATTTTAAAATCTTTGG + Intronic
1032673606 7:134107943-134107965 CCTTTCAAGAGTATAAGCTGAGG + Intergenic
1037855765 8:22369525-22369547 CCCTTCCAGTGCAAACTCTTGGG + Intronic
1039084848 8:33769749-33769771 CCTTGCCGATGAAAAATCTGTGG + Intergenic
1039228249 8:35413989-35414011 CCATTCCAGTCAAGAATCTGAGG - Intronic
1040834580 8:51718823-51718845 CTTTTAAAGTGTAAAATCAGTGG - Intronic
1041479985 8:58309097-58309119 CCTTTCAAGTATGAAATATGCGG + Intergenic
1044753674 8:95439941-95439963 ACTTTCCTGTGCAAGATCTGAGG + Intergenic
1046003439 8:108448758-108448780 CCTTTCCAGTTTATCTTCTGGGG + Intronic
1046411652 8:113851853-113851875 CTTATTCAGTGTAAAATCTAGGG - Intergenic
1047937570 8:129797587-129797609 ATTTTCCAGGGTAAAATCCGGGG - Intergenic
1048312575 8:133336945-133336967 CCTATGCATTGTAAAATATGTGG - Intergenic
1048649351 8:136457155-136457177 CCTGACCAGTGTAGACTCTGAGG + Intergenic
1049031199 8:140039053-140039075 CCCATCCGGTGTTAAATCTGTGG + Intronic
1049445505 8:142628773-142628795 CCTGCCCAGGGTACAATCTGAGG + Intergenic
1053141817 9:35687416-35687438 CCTTTCCACTCTGAAATCTCAGG - Intronic
1055350156 9:75378376-75378398 CCTTTCCAGAGTGGAATCTCAGG + Intergenic
1055596547 9:77871062-77871084 CTTTTCCAGTGTACACTGTGAGG - Intronic
1056272781 9:84963007-84963029 GCTTTCCAGTGTCAGAGCTGTGG + Intronic
1057454823 9:95198687-95198709 CATTTCCAGTGTAAATACTTGGG - Intronic
1059932122 9:119271349-119271371 CCTTTCCAGGGTGAAATCAAAGG - Intronic
1060357045 9:122918940-122918962 CCTTTCCAGTGTAAAATCTGTGG - Exonic
1187665044 X:21598223-21598245 TCTTGTCTGTGTAAAATCTGTGG + Intronic
1188108573 X:26170625-26170647 CCTTTCCTATGTAAAATTTCTGG - Intergenic
1190362970 X:49666571-49666593 CCTTTTAAGTGTAAGATCTGTGG - Intergenic
1192131545 X:68556632-68556654 ACTTTACAGTATGAAATCTGTGG - Intergenic
1192594798 X:72395214-72395236 CCTTTCCAGTTCCAAATTTGAGG + Intronic
1192853325 X:74980827-74980849 ACTTTCCTGAGTAGAATCTGGGG + Intergenic
1194946843 X:100079025-100079047 CCTTTCAAATGTAAAATCTGTGG + Intergenic
1195156773 X:102131097-102131119 CATTTGCAGTGGAAAATTTGAGG - Intergenic
1197710949 X:129666794-129666816 CCTTTCCAGCTTCAATTCTGTGG - Intergenic
1198034930 X:132792532-132792554 CATTTAAAGTGTAAAATTTGAGG + Intronic
1198296023 X:135287499-135287521 TCTCTCCAGTGTGAATTCTGTGG + Exonic
1198471047 X:136947211-136947233 TCTTTCCAGTGTAACACCTCTGG - Intergenic
1201367892 Y:13228433-13228455 CCTTTCCTCTGCAGAATCTGTGG + Intergenic
1201514192 Y:14799584-14799606 CCTCTTCAGTGCAAAGTCTGGGG - Intronic
1202274556 Y:23102160-23102182 CATTTCCATTGTAAAATTTATGG - Intergenic
1202291471 Y:23318526-23318548 CATTTCCATTGTAAAATTTATGG + Intergenic
1202427549 Y:24735896-24735918 CATTTCCATTGTAAAATTTATGG - Intergenic
1202443242 Y:24934198-24934220 CATTTCCATTGTAAAATTTATGG + Intergenic