ID: 1060358348

View in Genome Browser
Species Human (GRCh38)
Location 9:122931481-122931503
Sequence CTCCGGCCCCTCGGGGCTCC GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 424
Summary {0: 1, 1: 0, 2: 4, 3: 42, 4: 377}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060358337_1060358348 6 Left 1060358337 9:122931452-122931474 CCGCCGTCAGGATCCGGCACCGC 0: 1
1: 0
2: 0
3: 1
4: 51
Right 1060358348 9:122931481-122931503 CTCCGGCCCCTCGGGGCTCCGGG 0: 1
1: 0
2: 4
3: 42
4: 377
1060358333_1060358348 18 Left 1060358333 9:122931440-122931462 CCCGGGGGAAGGCCGCCGTCAGG 0: 1
1: 0
2: 0
3: 6
4: 112
Right 1060358348 9:122931481-122931503 CTCCGGCCCCTCGGGGCTCCGGG 0: 1
1: 0
2: 4
3: 42
4: 377
1060358335_1060358348 17 Left 1060358335 9:122931441-122931463 CCGGGGGAAGGCCGCCGTCAGGA 0: 1
1: 0
2: 3
3: 4
4: 96
Right 1060358348 9:122931481-122931503 CTCCGGCCCCTCGGGGCTCCGGG 0: 1
1: 0
2: 4
3: 42
4: 377
1060358341_1060358348 -7 Left 1060358341 9:122931465-122931487 CCGGCACCGCCAGGAGCTCCGGC 0: 1
1: 0
2: 2
3: 38
4: 297
Right 1060358348 9:122931481-122931503 CTCCGGCCCCTCGGGGCTCCGGG 0: 1
1: 0
2: 4
3: 42
4: 377
1060358338_1060358348 3 Left 1060358338 9:122931455-122931477 CCGTCAGGATCCGGCACCGCCAG 0: 1
1: 0
2: 0
3: 6
4: 87
Right 1060358348 9:122931481-122931503 CTCCGGCCCCTCGGGGCTCCGGG 0: 1
1: 0
2: 4
3: 42
4: 377

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060358348 Original CRISPR CTCCGGCCCCTCGGGGCTCC GGG Exonic
900142550 1:1144756-1144778 CGCCTGCCTCTCGGGGCTTCCGG + Intergenic
900142824 1:1145663-1145685 CTGCAGCCCCTCCGGCCTCCTGG - Intergenic
900168758 1:1255899-1255921 CTCCCCTGCCTCGGGGCTCCTGG + Intronic
900372896 1:2340130-2340152 CTCCTGCCCCTGGGCCCTCCGGG + Intronic
900375701 1:2353682-2353704 CTCAGGCCCCTAGGGGATCGGGG - Intronic
900376740 1:2358272-2358294 CTCCGGCCCTCGGGTGCTCCTGG - Intronic
900615491 1:3563873-3563895 CTCTGGCCTCTCAGGGCACCTGG - Intronic
900645159 1:3705696-3705718 CTCCTGCCCCTCCGGCATCCCGG + Intronic
900648039 1:3717847-3717869 CTCCGGCCCGGCTGGGCACCTGG + Intronic
900829986 1:4959063-4959085 CTCCGGCCTCTGGTGGCCCCAGG + Intergenic
900972387 1:5998729-5998751 CTGCGCCCCCTCGCTGCTCCTGG - Intronic
901489494 1:9589301-9589323 CTCCAGCCCCCCGCGGCTCCCGG - Intronic
902531498 1:17093652-17093674 CCCCTGGCCCTCGGGGCCCCAGG + Exonic
902546628 1:17194355-17194377 CTCTGGGGCCTCGGGGCTCCTGG + Intergenic
902618244 1:17635488-17635510 TGCCAGCCCCTCTGGGCTCCTGG + Intronic
902663831 1:17923764-17923786 CTCTGGCCCCTCCTGGCTCTGGG - Intergenic
902735839 1:18400163-18400185 CTCCGCCCTCTCATGGCTCCTGG - Intergenic
902864386 1:19268800-19268822 CACCCGCCCCTCAGGGCTGCAGG - Intergenic
902866610 1:19284215-19284237 CACCTGCCCCTCAGGGCTGCAGG - Intronic
902869621 1:19306246-19306268 CACCCGCCCCTCAGGGCTGCAGG - Intronic
903528846 1:24013978-24014000 CTCCGCCCCCTCGAGACTCCAGG - Intergenic
903596977 1:24502693-24502715 CTCCCGCTCCTCCGGGTTCCTGG - Intronic
903658977 1:24965525-24965547 CTCCGGCCGCTGGTGGATCCGGG - Intergenic
903779845 1:25814208-25814230 CCCAGGCACCTCGGGGCCCCGGG + Intronic
906293037 1:44632158-44632180 CTCCGGCCGCTCCGGGCTCTCGG - Intronic
907501986 1:54887465-54887487 CCCCAGGCCCTCGGGGCTGCGGG + Intergenic
913348096 1:117828216-117828238 CTCCAGCCCCTGGGGACTCTGGG + Intergenic
914674804 1:149900187-149900209 CTCTAGCACCTCGGGGCTCAGGG - Exonic
914831634 1:151174789-151174811 CTCTAGCTCCTCGGGGCTCAAGG + Exonic
915345564 1:155195255-155195277 CTCCGGCCCCCCCGGCCCCCCGG + Intergenic
916123646 1:161550564-161550586 CTCAGGCCCCTCCGGGCCACTGG + Intronic
916133531 1:161631919-161631941 CTCAGGCCCCTCCGGGCCACTGG + Intronic
916750161 1:167716402-167716424 CTCCGCCCCCTCCGCCCTCCAGG + Intergenic
918040753 1:180912768-180912790 AGGCGGCCCCGCGGGGCTCCGGG + Intergenic
919640305 1:200039539-200039561 CTCCGCCTCCTCGGGGCTGCCGG - Intronic
919657712 1:200213908-200213930 CTCCCGCCTCTGGGAGCTCCGGG + Intergenic
920201298 1:204261389-204261411 CTCTTGCTCCTCGGGGCTCTCGG + Exonic
920367779 1:205457117-205457139 CCCCCGCCCCTGCGGGCTCCCGG - Intergenic
920409674 1:205749655-205749677 CTCCGGCCGCTGGCGGCTCAGGG + Intronic
921039541 1:211416677-211416699 CTCCGGCCGCCCGGGGCCCCCGG - Intergenic
922505267 1:226122269-226122291 CCCCGGCCTCTCGGGGCCGCCGG + Intergenic
924415128 1:243850200-243850222 CGCCGGCCGCACCGGGCTCCAGG - Intronic
1062861380 10:813014-813036 CTCTGGTCTCTGGGGGCTCCAGG + Exonic
1062890535 10:1056673-1056695 CCCAGACCCCTCGGGGCTGCGGG + Intronic
1063592497 10:7407912-7407934 CTCTGGCACCTAGGGGCTCGGGG - Intronic
1065092951 10:22252846-22252868 CCCAGGCCTCTCGCGGCTCCCGG + Intergenic
1067091184 10:43266568-43266590 CTCCGCCCCTTCAGGGCACCTGG - Intronic
1070503313 10:77091388-77091410 CTCCAACCGCTCGGGGCTCCTGG + Intronic
1072456266 10:95579030-95579052 CTCCAGCCCCTCATGGCTACTGG - Intergenic
1072868303 10:99088020-99088042 CTCCAGCCACACTGGGCTCCTGG + Intronic
1073540834 10:104315346-104315368 CTCCGGCCGCTCAGTGCCCCTGG - Exonic
1075334439 10:121598272-121598294 CTCGGGGCCCCCGGGGCTCGCGG + Exonic
1075727684 10:124618876-124618898 CCCAGGCCCCTCAGGGCTGCAGG + Intronic
1075845833 10:125544496-125544518 CTCCTGCCCCATGGAGCTCCAGG + Intergenic
1076320694 10:129579356-129579378 CTCCTGACCCACGGGACTCCTGG - Intronic
1076828010 10:132979962-132979984 CTCCAGCCTCTCCGGCCTCCTGG + Intergenic
1077080074 11:721203-721225 CTCCAGCCCCTCGGCCCACCTGG - Exonic
1077368063 11:2169236-2169258 CTCCGGCCCCACTGTGCCCCGGG - Intronic
1080640436 11:34155354-34155376 CTCCGGGCCTCCGGGCCTCCGGG - Intronic
1081636757 11:44726968-44726990 CGCCGGCGTCGCGGGGCTCCAGG + Intronic
1083302190 11:61745113-61745135 CTCTGGCCCCTCCAGGCCCCTGG - Exonic
1083579906 11:63818344-63818366 CTCCGCCCCCTCGAGCTTCCTGG + Exonic
1083661287 11:64252686-64252708 CCCCGGCCCCTGGGGCCCCCAGG - Intronic
1084069956 11:66727831-66727853 CGCCGGCCCCTCGCGTCGCCGGG - Intronic
1084070167 11:66728466-66728488 CGGCGGCCCCGCGGGGCTCTGGG + Intronic
1084212550 11:67630640-67630662 GTCCCTCCCCTAGGGGCTCCAGG + Intergenic
1084263992 11:67995749-67995771 CTCCGGCCACCAGGGGCACCGGG + Exonic
1084430582 11:69108597-69108619 TTCCAGCTCCTGGGGGCTCCAGG - Intergenic
1084557968 11:69886122-69886144 CTCTGGCCCCTCAGAGCCCCTGG + Intergenic
1084780579 11:71405592-71405614 TTCCAGCTCCTGGGGGCTCCAGG - Intergenic
1085029862 11:73264507-73264529 CTCTGGCTCCTCTGGGTTCCAGG + Intronic
1085044825 11:73346741-73346763 CTCCTGCCGCCCAGGGCTCCGGG - Intronic
1085666175 11:78417523-78417545 CCCCGGCCCCCCGCGGCTCCGGG + Intronic
1087306921 11:96499658-96499680 CTCCGGCCACTCCAGTCTCCAGG + Intronic
1089354411 11:117840474-117840496 CTCCAGCCCCTCAGGGCACTGGG - Intronic
1089652212 11:119921784-119921806 CTCCAGGCCCTCTGGCCTCCTGG - Intergenic
1090636882 11:128694913-128694935 CGCCGGCTCCGCGGGACTCCTGG + Intronic
1091446441 12:546420-546442 ATCCGGCTGCTCCGGGCTCCTGG + Intronic
1091616411 12:2053761-2053783 CCCCGGTCCCGCCGGGCTCCCGG - Intronic
1092385394 12:8032783-8032805 CTCCGACCAGTCTGGGCTCCCGG - Exonic
1092504300 12:9080065-9080087 CTCCAGCCCCTAGTGGATCCGGG - Intronic
1096491480 12:52015283-52015305 CTCCCGCTGCTCTGGGCTCCTGG - Exonic
1096738862 12:53677180-53677202 CGCCGCCCCCTCCCGGCTCCCGG + Intronic
1096741217 12:53695550-53695572 CACCGGCCCCTGCGGCCTCCCGG + Intergenic
1096998583 12:55856477-55856499 TTCCAGCCCCTGGTGGCTCCAGG + Intergenic
1103562865 12:121801151-121801173 AGCCGGCTTCTCGGGGCTCCGGG - Intronic
1104417477 12:128607235-128607257 CTCCAGCCCCACTGGCCTCCTGG - Intronic
1104587693 12:130060761-130060783 TTCCAGCTCCTCGTGGCTCCAGG - Intergenic
1104633607 12:130424622-130424644 ACGAGGCCCCTCGGGGCTCCTGG - Intronic
1104918372 12:132278068-132278090 CTCTGGCCCCTGCGGGCTCTGGG + Intronic
1104930884 12:132338913-132338935 CTTCGGCCACGCGGCGCTCCTGG - Intergenic
1104944309 12:132408861-132408883 GGGCAGCCCCTCGGGGCTCCGGG - Intergenic
1105378282 13:19863965-19863987 CTTCGGCCCCTCGGGGCCCGGGG + Intergenic
1105388937 13:19958383-19958405 CTTCGGCTCCTCGGGGCCCGGGG - Intergenic
1106122328 13:26870868-26870890 CTCCAGTCCCTCTGGCCTCCTGG + Intergenic
1112291006 13:98143699-98143721 CTCGGGGGCCTCGGGGCTCCGGG + Intronic
1113906937 13:113823717-113823739 CCCCGGTGCCTCTGGGCTCCGGG - Intronic
1113940431 13:114015963-114015985 CTGCGTCCCCTGGGGGGTCCCGG - Intronic
1114485177 14:23057693-23057715 GTCCGCCCCCTCGGCGCTCCTGG + Intergenic
1114519016 14:23321507-23321529 CTGCGGGCGGTCGGGGCTCCGGG + Exonic
1115592279 14:34875224-34875246 CTCCGGCCCCGCCGCGCCCCTGG + Exonic
1117072507 14:52069301-52069323 CTCCGCCCCCAGGGAGCTCCCGG + Intergenic
1117680638 14:58199919-58199941 CTCCGCCCCCTCAGGGCGACCGG + Intronic
1117745910 14:58869425-58869447 CTCTGGCCCTGCAGGGCTCCAGG + Intergenic
1119443791 14:74647362-74647384 CTGAGGCCCCACAGGGCTCCCGG - Intergenic
1119666940 14:76491592-76491614 CTCCCGCCTCGCGGGGCTGCTGG + Exonic
1120194037 14:81463758-81463780 TTCCGGCTCCTAGTGGCTCCTGG + Intergenic
1121103373 14:91264766-91264788 CTCCCTCCCCCCGGGGCTCGAGG + Intergenic
1121137207 14:91509895-91509917 CGCGGCCCCCTCGGGGCTGCCGG - Exonic
1121183500 14:91947315-91947337 CTCTGGGCCCTCGGGGCTCGCGG + Exonic
1121653460 14:95576824-95576846 CCCTGGCCCCCAGGGGCTCCAGG + Intergenic
1122354355 14:101114221-101114243 CTCCGGGACCTGGGGGCTCCAGG - Intergenic
1123040334 14:105487718-105487740 CTCCCTCCCCTCGGGGCGCGCGG - Intronic
1124696737 15:31870263-31870285 CTCCGGACCCCGCGGGCTCCCGG - Intronic
1126953685 15:53910929-53910951 CTTTGGCCCCTGAGGGCTCCTGG + Intergenic
1128028652 15:64460789-64460811 CTCCGCCCGCCCGGGGCCCCGGG - Intronic
1128315125 15:66655157-66655179 GGCCGGTCCCTCTGGGCTCCTGG + Intronic
1128783507 15:70378460-70378482 CTCCAGCCCCTCCCTGCTCCAGG + Intergenic
1129206996 15:74043278-74043300 CTCCGGCTCACCTGGGCTCCTGG + Intronic
1129666074 15:77580044-77580066 CTCAGGCCCCCCGGGACTCACGG + Intergenic
1130390114 15:83447623-83447645 CTGCGGCCCCCCGAGGCTCCCGG + Intronic
1130784718 15:87083450-87083472 CTCCTGCTCCTCGAGGCTCCAGG - Intergenic
1132314636 15:100880611-100880633 CACCGGGACCTCTGGGCTCCGGG - Intronic
1132498798 16:275782-275804 CTCCGGCCCCTCCCGGCCTCGGG + Intronic
1132594040 16:740251-740273 CTCTGGCCCCGCGGGGCTGTTGG + Intronic
1132625642 16:890271-890293 CGGGGGCCCCTTGGGGCTCCAGG - Intronic
1132635063 16:940103-940125 TTCCAGCCCCTGGAGGCTCCGGG - Intronic
1132643139 16:987132-987154 CCCCTGCCGCTCGGGGGTCCGGG - Intergenic
1132675740 16:1120617-1120639 GTCAGGCCCCTGGGGGCACCCGG - Intergenic
1132676060 16:1121727-1121749 CCCCAGCCCCTCGGGGACCCAGG - Intergenic
1132805108 16:1771662-1771684 CTCCGGCCCCCCACGGCTGCCGG - Exonic
1133054849 16:3140779-3140801 CTCAGCCTCCTCGGGGCTCCAGG - Exonic
1133241331 16:4416181-4416203 CTGCGCCGCCTCGGGGGTCCCGG + Intronic
1135402891 16:22178374-22178396 CACAGGCCCCTTGGAGCTCCTGG + Intronic
1135422486 16:22314377-22314399 CTGCGGGTCCTCAGGGCTCCTGG - Intronic
1135821894 16:25692406-25692428 CACCGGGCCATCGCGGCTCCCGG - Exonic
1136409946 16:30070277-30070299 GGCCGCCTCCTCGGGGCTCCAGG + Exonic
1136459447 16:30400515-30400537 CCCAGGCCCCGCGGGGCGCCGGG - Intergenic
1137315598 16:47317864-47317886 CTCCAGCCTCTTGGGACTCCAGG + Intronic
1138389129 16:56657684-56657706 CACCCGCCCCTTGGGGTTCCGGG - Exonic
1138549383 16:57739299-57739321 CTCTGGCTCCTTGTGGCTCCAGG + Intronic
1139095821 16:63703656-63703678 CTGCGGCCGCTCGGAGATCCTGG + Intergenic
1139470322 16:67174765-67174787 CTCTGGCTCCTCCGGGGTCCCGG - Exonic
1140476688 16:75242586-75242608 CTCCAGGCCCTGGGGGCACCTGG + Exonic
1140512276 16:75517041-75517063 CTCACGCCCAGCGGGGCTCCGGG + Intergenic
1141423957 16:83933718-83933740 CTCCGGCTTCAGGGGGCTCCAGG + Intronic
1141679292 16:85535116-85535138 CCCCGGCCCCAAAGGGCTCCAGG + Intergenic
1141863512 16:86733999-86734021 TTCCTGCTCCTGGGGGCTCCAGG + Intergenic
1142032349 16:87844801-87844823 CTCTGGCCCCTTGGGGCTCTAGG + Intronic
1142371871 16:89686986-89687008 CCCCGGCCCCTCAGATCTCCAGG - Intronic
1142403566 16:89873712-89873734 CGCCGGGCCCGAGGGGCTCCTGG - Exonic
1142480159 17:214114-214136 CACCTGCCCCTCTGGGCTTCAGG + Intronic
1142611141 17:1109647-1109669 CTCCGGCGCATGGGGACTCCGGG - Intronic
1142757751 17:2025656-2025678 CCCCGGCCCCGCAGGCCTCCTGG + Intergenic
1142859052 17:2749789-2749811 CCCGGGGCTCTCGGGGCTCCCGG - Intergenic
1142991299 17:3732878-3732900 CACCTGCCCCTCGGGGGTCCAGG - Intronic
1143109283 17:4544433-4544455 CTCCTGCGCCTGGGGGCTGCCGG + Intronic
1143865152 17:9917972-9917994 TTCCAGCCCAGCGGGGCTCCCGG - Intronic
1144324165 17:14161759-14161781 CTCAGGACCCAGGGGGCTCCTGG - Intronic
1144653319 17:17020222-17020244 GTTCGGCCACTCTGGGCTCCAGG + Intergenic
1145796033 17:27655770-27655792 CGCCGACCCCTGGGGGTTCCGGG - Intergenic
1146053164 17:29568089-29568111 CTCCGGCCTCCCGGGGCTTCTGG + Intronic
1146404938 17:32528788-32528810 CTCCGGCCTCTGGGAGCTGCCGG - Intronic
1146633250 17:34485432-34485454 CTCCAGCTCCTCAAGGCTCCGGG - Intergenic
1146824201 17:36009219-36009241 CTCCCGCCCCTCGTGGCCACTGG - Intergenic
1147139567 17:38453757-38453779 GTCCGTCCCTTCGGGGCCCCCGG + Intronic
1147672430 17:42184318-42184340 GTCCGGGCCCCCGGGCCTCCAGG - Exonic
1148736704 17:49869253-49869275 GTCAGGGCCCTCTGGGCTCCTGG + Intergenic
1148782447 17:50129618-50129640 CCCCGGCCGCGGGGGGCTCCGGG + Exonic
1149910331 17:60560632-60560654 CTTCAGCCCCTGAGGGCTCCCGG - Intergenic
1149974529 17:61252501-61252523 CTCCGGCCCCTCTGGAGCCCTGG - Intronic
1150809698 17:68346853-68346875 CTCAGGCTTCTCCGGGCTCCTGG + Intronic
1151025100 17:70669010-70669032 CTTCAGCCCCTGAGGGCTCCTGG + Intergenic
1151432388 17:74072300-74072322 TTCCAGCTCCTGGGGGCTCCAGG + Intergenic
1151487594 17:74411062-74411084 CTCCAGCTTCTGGGGGCTCCAGG - Intergenic
1151783780 17:76265416-76265438 GGCCGGCCGCCCGGGGCTCCGGG - Exonic
1151869151 17:76824788-76824810 CTCCAGCATCTGGGGGCTCCAGG + Intergenic
1152113009 17:78367477-78367499 GTCAGGCCCCTGGGGGCTGCAGG + Intergenic
1152137107 17:78510991-78511013 CTCCAGCTTCTGGGGGCTCCAGG - Intronic
1152310243 17:79545509-79545531 CTCCGCTCCCTCTGGGCCCCTGG - Intergenic
1152342645 17:79733755-79733777 CTCCAGGGTCTCGGGGCTCCTGG + Intronic
1152733208 17:81983640-81983662 CTCAGGCCCCTCACGGCTCCGGG - Exonic
1155954016 18:31942459-31942481 CTGTGGCCCCGCGGTGCTCCGGG - Intronic
1156829075 18:41468745-41468767 CTCTGGCCTCCTGGGGCTCCAGG + Intergenic
1158195243 18:54877619-54877641 CTCCTGGCCCTCGGGGATTCAGG + Exonic
1160017775 18:75157616-75157638 CTCCAGCTCCTGGGGGCTCCCGG - Intergenic
1160236419 18:77089501-77089523 CTGCTGCCCCTCAGGGCTTCTGG - Intronic
1160392037 18:78541173-78541195 CTCAGCCCCCTCGTGCCTCCCGG + Intergenic
1160540252 18:79617199-79617221 CTCCGGCTTCTCGGGGCCACGGG - Intergenic
1160613788 18:80109150-80109172 CACAGGCCCCCCGGGGCCCCTGG - Exonic
1160866892 19:1260164-1260186 CCCCTTCCCCTGGGGGCTCCCGG - Intronic
1160876790 19:1300152-1300174 CCCCGGCCCCTCGGGCCTCCGGG - Exonic
1160940521 19:1618542-1618564 CTCCAACCCCACGGGTCTCCTGG + Intronic
1161148140 19:2691975-2691997 CCCCACCCCCTGGGGGCTCCAGG - Intronic
1161196083 19:2987479-2987501 ATCCTGCCCCTCGGGTCCCCCGG + Intronic
1161304073 19:3557376-3557398 CTCCGGCCGCTGGGGGTCCCGGG + Exonic
1161322062 19:3645906-3645928 CTCCTGCCCCACGGCGCTCTGGG + Intronic
1161479386 19:4503128-4503150 CCCCGGCCCCTCACGGCCCCTGG + Exonic
1161610592 19:5240250-5240272 CTCCTGCCGCGGGGGGCTCCAGG + Exonic
1162267096 19:9584569-9584591 CTCGGGCCGGGCGGGGCTCCTGG + Intergenic
1162278224 19:9675122-9675144 CTCCGGCCGGGTGGGGCTCCAGG + Intergenic
1162778978 19:12996694-12996716 CTCCCGCCCCTCCCGCCTCCAGG - Intronic
1162951003 19:14072269-14072291 CTCCGGCCCGAGGGGGCGCCAGG - Intergenic
1163117298 19:15196161-15196183 CTCCGGGCGATCCGGGCTCCGGG + Intronic
1163577259 19:18118075-18118097 GTCCGGCTCCGCGGGGCTCCTGG + Intronic
1163686555 19:18715123-18715145 CTCCTGCCTCTGGGGGCTCCCGG + Intronic
1163755281 19:19102964-19102986 TTCCGGCTTCTGGGGGCTCCTGG + Intronic
1164649755 19:29883135-29883157 CTCCAGGCCCTCCTGGCTCCTGG - Intergenic
1165943643 19:39428464-39428486 CTCCGTCACCACGGGGCCCCCGG - Intergenic
1166074920 19:40408351-40408373 CTCCAGCTCCTTGGGCCTCCTGG + Exonic
1166304153 19:41928165-41928187 CTCTGCCTCCCCGGGGCTCCGGG - Intronic
1168074063 19:53969626-53969648 TTTCAGCCCATCGGGGCTCCAGG + Intronic
1168152640 19:54457098-54457120 CACCCGCCACGCGGGGCTCCAGG - Intronic
925020556 2:564608-564630 CCCCGGCCCCACGCGGCGCCAGG - Intergenic
925133779 2:1512534-1512556 CTCCGCCCCTGCTGGGCTCCTGG + Intronic
925303083 2:2830699-2830721 CTCAGGCTCTTCAGGGCTCCAGG + Intergenic
925389860 2:3487300-3487322 TTCCGGCCTCTGGGGGCTCCCGG + Intergenic
926934389 2:18072577-18072599 CTCCCCCTCCTCTGGGCTCCTGG + Intronic
927092653 2:19723791-19723813 CTCCTGCCACACGGGCCTCCTGG + Intergenic
927881502 2:26692836-26692858 CGCCGGCCCCCCGGCGCCCCCGG - Exonic
928205204 2:29278933-29278955 CTCAAGCCCCTCTGGCCTCCTGG - Intronic
929779011 2:44945807-44945829 CTCCTCCCACTCGGTGCTCCTGG + Exonic
931739359 2:65228047-65228069 CTCCGGGCCCTCGGGGCGAAGGG + Intronic
933728116 2:85437836-85437858 CTCCGCACCCCCGGGCCTCCCGG + Intergenic
934949409 2:98566175-98566197 TGCCGGCTCCTCGGGGCTGCGGG + Intronic
939178747 2:138780706-138780728 ACCCGGCCTCTCGGGGCTCTGGG - Intergenic
940830880 2:158463927-158463949 CTCCTGCCCCGAGGGGCCCCAGG - Intronic
943639541 2:190343642-190343664 CGCTGCCGCCTCGGGGCTCCCGG - Exonic
946229345 2:218282061-218282083 CTCCGCCCCCTGGGGGCTATGGG - Exonic
946432393 2:219632591-219632613 GCCCTGCCCCTCGGGGCTCACGG - Intronic
946495732 2:220193397-220193419 CTCCGGCCTCTCCCTGCTCCTGG - Intergenic
946767342 2:223052890-223052912 CGCCGGCCGCACGGGACTCCAGG - Exonic
947118625 2:226796396-226796418 CTCCGGCTCCCCGGGGCGCTGGG + Exonic
947277643 2:228411596-228411618 CTCTGGCCCCACTGGCCTCCTGG + Intergenic
947353669 2:229271400-229271422 CTCCCGCCCCGCGCGGCCCCTGG - Intergenic
947989802 2:234477706-234477728 CTCCAGCTCCTGGGGGCTTCCGG - Intergenic
948197066 2:236104130-236104152 CTCCCGCCTTGCGGGGCTCCTGG - Intronic
948689048 2:239690709-239690731 CTCCGCCCCCCCGGGACGCCGGG - Intergenic
948781438 2:240324171-240324193 CCTCGGCCCTTCGGGGCCCCAGG + Intergenic
948836659 2:240629248-240629270 CTCTGGCCCCTGGGAGCTCAAGG + Intronic
949014705 2:241702515-241702537 CTCCGGGCCTTGGGGGCTCCGGG + Intronic
1169048781 20:2559012-2559034 CTCCAGCGCCTCGTGGCACCCGG + Intronic
1169284739 20:4298523-4298545 CTCCAGCCCCTCAGAACTCCAGG - Intergenic
1170756949 20:19213022-19213044 CTCCGGCGGCTCGGGGCTCCCGG + Intronic
1171249594 20:23637952-23637974 CGCCGGCCTCGCGGGGCTCACGG - Intronic
1171266519 20:23776089-23776111 TTCCTCCTCCTCGGGGCTCCAGG + Intergenic
1171461534 20:25300751-25300773 TGCCGGCCCCCCGGGGCTTCAGG + Intronic
1171876809 20:30585271-30585293 CTCCGCCCTCGCGGTGCTCCCGG + Intergenic
1172082181 20:32350803-32350825 CTCCTGCCCCTCTGGACTGCTGG + Intergenic
1172625037 20:36342036-36342058 CTCCGGCCACCAGGGGTTCCTGG - Intronic
1173516207 20:43667177-43667199 CTCCGGCCGCTCCGGGCCCCGGG - Exonic
1173561744 20:44010980-44011002 CTCCGGCTCCTGGGGGTTGCTGG + Intronic
1174081009 20:47970740-47970762 CCCCAGCCACACGGGGCTCCTGG + Intergenic
1174135489 20:48376116-48376138 CCCCAGCCACACGGGGCTCCTGG - Intergenic
1174509492 20:51040391-51040413 TTCCAGCTCCTGGGGGCTCCTGG + Intergenic
1175595887 20:60232337-60232359 TTCAGGCCTCTCTGGGCTCCAGG + Intergenic
1175889709 20:62310752-62310774 GTGCGGCCCCTCCTGGCTCCAGG + Exonic
1175991779 20:62793460-62793482 CTCAGCACCCTCGGGTCTCCTGG + Intergenic
1178453605 21:32727569-32727591 CTGGGGCTCCTCGGGGGTCCCGG + Intronic
1178562406 21:33651142-33651164 CTCAGAGCCCTCGGGCCTCCAGG - Intronic
1180867529 22:19127924-19127946 CTCCCTCGCCTCTGGGCTCCAGG + Intergenic
1181008257 22:20024843-20024865 CTCTGGCCCCCAGGGTCTCCAGG + Intronic
1183376362 22:37467726-37467748 TTCCAGCCCCACGGGGCTGCAGG + Intergenic
1183539113 22:38419397-38419419 CACCTGCCCCTCTGGCCTCCTGG - Intergenic
1183669221 22:39262524-39262546 CTGCAGCCCCTCGGGCCTCTTGG + Intergenic
1183942802 22:41305618-41305640 GTCCAGCCCCTCGGGGCCCTGGG - Intronic
1184222513 22:43110095-43110117 CCCCCTCCCGTCGGGGCTCCGGG - Intergenic
1184607312 22:45581599-45581621 CTCCTGACCCTTGGGCCTCCCGG + Intronic
1184688025 22:46105136-46105158 CCCTGGCCCCTGGGGGTTCCTGG - Intronic
1184766972 22:46577181-46577203 CCCCGGCGCCGCTGGGCTCCCGG + Intronic
949500944 3:4679471-4679493 CTCCTGCCCATCAGAGCTCCAGG - Intronic
951627924 3:24686771-24686793 CGCTGGCCACTCTGGGCTCCTGG - Intergenic
952335786 3:32401894-32401916 CTCCAGCCACCCGGCGCTCCTGG + Intronic
952929345 3:38347207-38347229 CTCCGGCCCCTCTGGGCACCGGG - Intronic
953623931 3:44555155-44555177 TTCCGCCCCCTCCGGGATCCCGG - Intergenic
953983641 3:47425655-47425677 CCCCGGCCCACTGGGGCTCCCGG + Intronic
954156182 3:48686042-48686064 CTCTGGTCCCTCCCGGCTCCAGG + Intronic
954614567 3:51963051-51963073 CTCCTGCTCCAAGGGGCTCCTGG - Intronic
955656612 3:61251198-61251220 CGCCGGCCCCACTGGGCTCCGGG + Intronic
961013229 3:123449216-123449238 CAACGGCCCCCCCGGGCTCCAGG - Exonic
963081845 3:141402240-141402262 CCCCGGGCCCGCGGGGCTGCGGG + Intronic
963346190 3:144098958-144098980 CTCAGGCCCCTAGGAGCACCAGG - Intergenic
963603542 3:147396407-147396429 CTCCAGCCCCTCGGTGTTCCCGG - Exonic
966846571 3:184135221-184135243 CTCAGACCCCTGTGGGCTCCCGG + Intronic
968047594 3:195632633-195632655 CTGCGGTCCCACGTGGCTCCTGG + Intergenic
968230397 3:197002254-197002276 CTCCGCGCCCACGCGGCTCCCGG + Exonic
968317479 3:197736784-197736806 CTCCGGCCCCAGGGGGCCCCGGG - Intronic
968451265 4:677096-677118 CACCTGCCCCTCGGTGCTGCAGG - Intronic
968504730 4:966589-966611 CCACGGGCCCTGGGGGCTCCGGG - Intronic
968514767 4:1011473-1011495 CCCCCGCCCCGCCGGGCTCCCGG - Intronic
968726124 4:2248581-2248603 TTCCGGCCCCACTGGGGTCCAGG - Exonic
968756420 4:2418461-2418483 CGCCGCCCGCTCGGCGCTCCGGG - Exonic
969114038 4:4860300-4860322 CTCGGGCTTCTCGGGGCTCTCGG - Exonic
969600608 4:8173945-8173967 CACCTGCCCCTCGGGGCTGGAGG + Intergenic
969672196 4:8595946-8595968 CTCCCGCCCCTCCCGGCTCCTGG - Intronic
971018993 4:22515839-22515861 CTCCTGCCCGCCCGGGCTCCGGG - Exonic
974056189 4:56985339-56985361 CACCGGTCCCTCGCGGCTACCGG - Intronic
975661098 4:76689652-76689674 CCCGGGCTGCTCGGGGCTCCAGG - Intronic
976398601 4:84583277-84583299 CTGCGGCTCCGCGGGACTCCAGG + Exonic
979624153 4:122827134-122827156 CTCCAGCGGCTCGGGGATCCCGG + Exonic
981920257 4:150078597-150078619 CTTCCTCCCCTCGGCGCTCCCGG + Intronic
984715068 4:182917467-182917489 CTCCCTCCCCTCAGGGCTTCGGG - Intronic
984811094 4:183797356-183797378 CTCCGCCCCCGCGGGGCCGCTGG + Intergenic
984973440 4:185209971-185209993 CTCCGGCCGCCCGGGGCCCCCGG - Intronic
985530207 5:429573-429595 CCTCGGCCCCTCGGCGCTGCAGG + Intronic
985550184 5:528786-528808 CTCCCCCCGCCCGGGGCTCCGGG + Intergenic
985576781 5:677329-677351 CACCTGCCCCTCCAGGCTCCAGG + Intronic
985639110 5:1054975-1054997 CTCCGACCCCCCTGTGCTCCTGG - Intronic
986293951 5:6422202-6422224 CTCTGGCGTCTGGGGGCTCCCGG - Intergenic
986622586 5:9691285-9691307 TTCCGGCTTCTGGGGGCTCCAGG - Intronic
986858923 5:11904129-11904151 TGCGGGCTCCTCGGGGCTCCGGG + Intergenic
987427245 5:17787231-17787253 TTCTAGCCCCTCAGGGCTCCAGG + Intergenic
989071318 5:37514549-37514571 CTGGGGCCCCTCGGGGGTGCAGG - Intronic
989480558 5:41925559-41925581 CCCAGGCCCCGGGGGGCTCCAGG - Intronic
990120671 5:52447202-52447224 CTCCAGCCACTCTGGGCTTCTGG - Intergenic
990509896 5:56480938-56480960 CCCCGGCCCAGCGCGGCTCCCGG + Intronic
993504145 5:88691113-88691135 CACTGGCCCCTCGCGGCTCGCGG - Intergenic
995854411 5:116576602-116576624 CTCCGGACCCTTCGGCCTCCGGG + Intergenic
998077250 5:139246708-139246730 CTGCAGCCCCTAGGGGCTGCTGG + Intronic
999253990 5:150199383-150199405 ATCCAGCCCCTCAGGCCTCCGGG - Intronic
999279773 5:150357615-150357637 CTCCGGCCGCGCGGCGCGCCGGG - Intergenic
999685860 5:154102389-154102411 ATCCGGCCCCTGGGGGCTGCAGG - Intronic
1001573595 5:172747221-172747243 CTCCTGCTCCTTGGAGCTCCTGG - Intergenic
1002603162 5:180366454-180366476 CTCCGGCCACTCTGGGCTCCGGG - Intergenic
1002795215 6:466262-466284 CTCCCGCCTCCCGGGGCTCCAGG - Intergenic
1003324937 6:5084584-5084606 CTCCGGCCGCTCTCGGCTGCGGG + Exonic
1004308526 6:14522998-14523020 CTCCTGCCCCTCAGCACTCCTGG - Intergenic
1005328008 6:24720800-24720822 CTCGGGCGCCTCGCGGGTCCGGG + Exonic
1006148096 6:31971139-31971161 CTCCTGCCTCTCAGGGGTCCAGG - Exonic
1006374114 6:33662475-33662497 CTGCGGCCCCTCCAGGCTCAAGG - Intronic
1006376575 6:33674602-33674624 CTCCAGCCCCTCAGGGCTTCGGG - Intronic
1006512066 6:34526755-34526777 CTGCGGCCCCGTGGGGCTCTGGG - Intronic
1006963801 6:37961399-37961421 CTCTGGCCCCTCCAGGATCCTGG + Intronic
1007079238 6:39086949-39086971 CTCTTGGCCCTCTGGGCTCCTGG - Exonic
1009431729 6:63572914-63572936 GCCGGGCCCCTCGGGGCTGCGGG + Intronic
1010378530 6:75202335-75202357 CGCCCGCTCTTCGGGGCTCCTGG + Intronic
1013619352 6:111873082-111873104 CGCCGCCCCCTCGGTGCTCTCGG - Exonic
1015496675 6:133889980-133890002 CTCCGGTCCCTGGAGGCTCTAGG - Intronic
1017326826 6:153150339-153150361 CTTCAGCCCCTGAGGGCTCCTGG + Intergenic
1019562585 7:1665936-1665958 CGCCGGCTCCGCTGGGCTCCGGG + Intergenic
1020746920 7:12090600-12090622 CTTCAGCCCCTGAGGGCTCCTGG + Intergenic
1022363446 7:29685325-29685347 CGACTGCCCCTCGGGGCGCCGGG - Intergenic
1022714925 7:32891210-32891232 CTCGGCGCCCGCGGGGCTCCCGG - Intronic
1023722693 7:43112764-43112786 CTCCGCTCTCTCGGGGCACCCGG + Exonic
1023881828 7:44325231-44325253 CGCCGGCTTCTCTGGGCTCCGGG - Intronic
1023991233 7:45130039-45130061 CTCACACCTCTCGGGGCTCCAGG + Intergenic
1024231949 7:47369393-47369415 CTCAGGCCCCTCCTGGTTCCTGG + Exonic
1025697921 7:63789711-63789733 CGCCGGCCGATCGGGCCTCCAGG + Intergenic
1025819260 7:64947456-64947478 CCCCGGCTCCTGGCGGCTCCTGG - Intergenic
1026822312 7:73557729-73557751 CGCCCGCCCCTTGGGGCTCACGG + Exonic
1026900399 7:74033799-74033821 CCCATGCCCCACGGGGCTCCCGG + Intronic
1026930657 7:74221444-74221466 CTCCAGCCCCTGGTGGCTCAGGG + Intronic
1027774226 7:82444110-82444132 GACCAGCCCCGCGGGGCTCCCGG + Intergenic
1029439182 7:100577843-100577865 CTCTGGGTCCCCGGGGCTCCCGG + Exonic
1029735846 7:102465324-102465346 ATGAGGCCCCTCGGGGCTCCCGG - Intronic
1030235332 7:107253756-107253778 CTCCAGCCACTCGGGCCTCCTGG + Intronic
1034100097 7:148443552-148443574 CTCCGACCCCTCTGTGCTTCTGG - Intergenic
1034275621 7:149822594-149822616 CCCTGGCCCCTCGGGACGCCGGG - Intergenic
1034672401 7:152868646-152868668 CTCGGGCCCCTCCTGGCTTCTGG + Intergenic
1035609107 8:948540-948562 CTCAGGCCCCGTGGGGCTCAGGG - Intergenic
1035675905 8:1455381-1455403 CCCCTGCCCCTCGGGGTCCCAGG + Intergenic
1036398123 8:8386106-8386128 CTCCAGCTCCTCGGTCCTCCCGG + Intronic
1037803973 8:22049300-22049322 CCCCGGCCCCGCGGGGACCCGGG - Intronic
1040556223 8:48479426-48479448 CTCCTGCCCATCAGAGCTCCCGG - Intergenic
1041515003 8:58690683-58690705 CTCGGGCCCTCGGGGGCTCCCGG + Intergenic
1042591423 8:70402589-70402611 CTCGGGCCCCTGGGGGGTGCTGG - Intronic
1043873820 8:85463775-85463797 CTCCGGGGCTCCGGGGCTCCGGG - Intergenic
1044973754 8:97644271-97644293 CTCCCGCCTCCCGGGTCTCCTGG + Exonic
1045971241 8:108082340-108082362 CTCCGGCTCCCCGCGCCTCCAGG + Intronic
1049263318 8:141651698-141651720 CTCCCGCCCCTGGGGGAGCCAGG + Intergenic
1049367641 8:142248422-142248444 CTCAGCACCCACGGGGCTCCTGG + Intronic
1049405357 8:142449851-142449873 ATCCGGACCCTCCGGGCGCCCGG + Exonic
1049525278 8:143122316-143122338 CTCCGCCCTCACGGGGCTGCGGG - Intergenic
1049694709 8:143977504-143977526 CGACGACCCCTCTGGGCTCCCGG - Exonic
1052335469 9:27315074-27315096 CTCCAGCCCCTCTGGCCTCCTGG - Intergenic
1056992590 9:91424559-91424581 CTCCGGGCCGTCGCGGCTCTCGG - Intergenic
1057046676 9:91891691-91891713 CTGCAGCCCCTCTCGGCTCCTGG + Intronic
1057432080 9:95004463-95004485 CAGTGGCCCCTCGGGGCTCCGGG - Intronic
1060283336 9:122228281-122228303 CTCCAGCCCCTCGGCGCGCCGGG + Intronic
1060358348 9:122931481-122931503 CTCCGGCCCCTCGGGGCTCCGGG + Exonic
1060375451 9:123112320-123112342 CGCCTGCCCCGCGGGGCTGCTGG + Intronic
1060412132 9:123406818-123406840 CCCCTGCCCCGCGGGGCCCCGGG + Intronic
1060945200 9:127566417-127566439 CACCAGCCCCGTGGGGCTCCTGG + Intronic
1060976925 9:127770430-127770452 CTCAGGCCCATCTGGGCTACTGG + Intronic
1061208279 9:129176794-129176816 CCCCAGCCCCGCGGGGCCCCGGG + Exonic
1061285544 9:129620425-129620447 CTCTGGGCGCGCGGGGCTCCGGG - Exonic
1061329043 9:129880830-129880852 CTCCGAGTCTTCGGGGCTCCGGG - Exonic
1061541069 9:131278014-131278036 CGCCGGCCCCGCGGGGATGCAGG + Intergenic
1061725959 9:132582201-132582223 CTCCGCGCCCTCGCCGCTCCGGG - Exonic
1061839385 9:133348705-133348727 CTCTGGCCACTCGGGGTTCCCGG + Intronic
1061880182 9:133565068-133565090 CTGCTGCCCTTCGGCGCTCCAGG + Intronic
1062022491 9:134326142-134326164 CGCCGCCTCCTCGCGGCTCCCGG + Intronic
1062050017 9:134442432-134442454 CACGGACCCCTCGGGGCTCTGGG + Intergenic
1062261739 9:135666284-135666306 TTCCGGCTGCTGGGGGCTCCAGG + Intronic
1062315444 9:135964888-135964910 CTCCAGCTCCTGGGGACTCCGGG + Intergenic
1062354785 9:136156853-136156875 CACCAGCCACTCGGGGCCCCGGG - Intergenic
1062651684 9:137581024-137581046 CTGAGGGCACTCGGGGCTCCAGG + Intergenic
1185445204 X:254195-254217 TCCCGGCTCCTGGGGGCTCCAGG + Intergenic
1185614716 X:1413849-1413871 TTCCAGCTCCTGGGGGCTCCAGG - Intronic
1185621966 X:1455480-1455502 CTCCCGCTCCTGGGGGCTCCAGG + Intergenic
1185622023 X:1455812-1455834 TTCCAGCTCCTGGGGGCTCCAGG + Intergenic
1185710305 X:2298166-2298188 CCCCAGCTCCTGGGGGCTCCAGG - Intronic
1185758701 X:2672982-2673004 CTCCTGCCCCTCCTAGCTCCTGG - Intergenic
1185813549 X:3132550-3132572 TCCCGGCTCCTGGGGGCTCCAGG + Intergenic
1185865401 X:3619626-3619648 TCCCAGCCCCTGGGGGCTCCGGG - Intronic
1185875004 X:3694866-3694888 TCCCGGCTCCTGGGGGCTCCAGG - Intronic
1185888203 X:3801832-3801854 CTCCAGCTCCTGGGGGCTCCCGG - Intergenic
1185970263 X:4654693-4654715 TTCCAGCTCCTGGGGGCTCCAGG + Intergenic
1186067247 X:5779054-5779076 TTCCAGCTCCTCGTGGCTCCAGG - Intergenic
1187669849 X:21657272-21657294 CGCGGGCCCCGCGGGACTCCTGG - Exonic
1189369589 X:40417135-40417157 CTCAGGCACCCTGGGGCTCCTGG + Intergenic
1192361792 X:70445265-70445287 CTGCGGCGCCTCGAGCCTCCGGG + Exonic
1192510751 X:71719226-71719248 CCCTGGCCCCGTGGGGCTCCGGG - Intergenic
1192515946 X:71762327-71762349 CCCTGGCCCCGTGGGGCTCCGGG + Intergenic
1192795246 X:74420734-74420756 CTGAGGCTCCTCCGGGCTCCAGG + Intergenic
1194142527 X:90222799-90222821 CTCTGGCCACTCTGGCCTCCAGG - Intergenic
1196085897 X:111681787-111681809 CGTCGTCCCCTCAGGGCTCCCGG + Intronic
1197264192 X:124348438-124348460 CTTCAGCCTCACGGGGCTCCTGG + Intronic
1199717627 X:150517547-150517569 CTCAGGCCCCTGGGGGCCTCAGG + Intergenic
1199721313 X:150544559-150544581 CCCTGGCCCCTCTGGACTCCAGG + Intergenic
1200088600 X:153624012-153624034 TTCCAGCTCCTGGGGGCTCCAGG - Intergenic
1200402677 X:156028755-156028777 CACCGCCCCCTCGTGGCGCCGGG - Intergenic
1200488282 Y:3791900-3791922 CTCTGGCCACTCTGGCCTCCAGG - Intergenic
1200585732 Y:5003059-5003081 CTTCGGCCCCTCCTGGGTCCTGG + Intronic