ID: 1060359250

View in Genome Browser
Species Human (GRCh38)
Location 9:122939748-122939770
Sequence TTGTAACTGTATAAGGAGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060359247_1060359250 16 Left 1060359247 9:122939709-122939731 CCTAATACTTTATTCTTTGAATA No data
Right 1060359250 9:122939748-122939770 TTGTAACTGTATAAGGAGAAAGG No data
1060359246_1060359250 17 Left 1060359246 9:122939708-122939730 CCCTAATACTTTATTCTTTGAAT No data
Right 1060359250 9:122939748-122939770 TTGTAACTGTATAAGGAGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060359250 Original CRISPR TTGTAACTGTATAAGGAGAA AGG Intergenic
No off target data available for this crispr