ID: 1060371594

View in Genome Browser
Species Human (GRCh38)
Location 9:123078608-123078630
Sequence GTGCTGAACCAGGCTGAGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 348
Summary {0: 1, 1: 0, 2: 3, 3: 27, 4: 317}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060371594 Original CRISPR GTGCTGAACCAGGCTGAGGT GGG (reversed) Intronic
900110791 1:1004702-1004724 CTGCTGTACCAGGACGAGGTGGG + Intergenic
900486888 1:2926905-2926927 GTGCTGAACTGAGCTGAGCTGGG + Intergenic
900486898 1:2926970-2926992 GTGCTGAGCTGGGCTGAGCTGGG + Intergenic
900486904 1:2927000-2927022 GGGCTGAACTGGGCTGAGCTGGG + Intergenic
900832061 1:4972584-4972606 GTGCTTTGGCAGGCTGAGGTGGG + Intergenic
901203422 1:7479647-7479669 GAGCTGAGCTAGGCTGAGCTGGG - Intronic
901644704 1:10710182-10710204 GTGCTGAGCCAGCCTCAGGGTGG - Intronic
902397172 1:16138749-16138771 GTGCTGAGCTAGGCTGTGATGGG - Intronic
902452470 1:16505823-16505845 GTGCTTTAGAAGGCTGAGGTAGG + Intergenic
903667542 1:25017141-25017163 GGGCTGCACCAGGCAGAGGTGGG + Intergenic
904482938 1:30805452-30805474 GTGCTGGGGCAGGCTGGGGTGGG + Intergenic
905448607 1:38043460-38043482 CTGGTGACCCAGGCCGAGGTGGG + Intergenic
910394900 1:86782448-86782470 GTGCTGAAACAGGCTGGGCATGG + Intergenic
910790195 1:91042804-91042826 GTGTTGAACAAGGATGTGGTGGG - Intergenic
910888077 1:91987580-91987602 AGGCTGAGGCAGGCTGAGGTGGG - Intronic
912431995 1:109632907-109632929 TTGCTGAAAGAGGCTGGGGTGGG - Intergenic
913452913 1:119004272-119004294 ATGCTGACTGAGGCTGAGGTGGG + Intergenic
915601919 1:156927799-156927821 GCCCTGAAGCTGGCTGAGGTGGG + Exonic
915913922 1:159930226-159930248 GTGCTGGACCCGGCTGTGGCAGG - Exonic
917157096 1:172014859-172014881 TTGCTGTACCAGGGTGATGTAGG + Intronic
917955398 1:180091263-180091285 ATGTTCAACCAGGCTGAGGTGGG - Intronic
921057497 1:211554687-211554709 CTACTGAAAGAGGCTGAGGTGGG + Intergenic
921067413 1:211632665-211632687 GAGCTGCTCCAGGCTGCGGTGGG + Intergenic
921290875 1:213656236-213656258 GTGCTGCCACAGGCTGAGATTGG - Intergenic
921385914 1:214569539-214569561 GTGATGACTCAGGATGAGGTTGG - Intergenic
922784393 1:228275925-228275947 GTGCAGAACCAGGCGGTGGCGGG - Exonic
924794272 1:247281290-247281312 CTGCTGCTCCAGGCTGAGGGTGG + Intergenic
1062897643 10:1116362-1116384 GTGGAGACCCAGGGTGAGGTGGG - Intronic
1064236461 10:13580665-13580687 GTGGTAACCCTGGCTGAGGTGGG + Intergenic
1065724889 10:28659918-28659940 GTGCTTTAGGAGGCTGAGGTGGG - Intergenic
1067113237 10:43415702-43415724 GTGCTTTTGCAGGCTGAGGTGGG + Intergenic
1067390395 10:45857923-45857945 GGGATGACCCAGGCTGAGCTGGG + Intergenic
1067501081 10:46805939-46805961 GGGATGACCCAGGCTGAGCTGGG - Intergenic
1067593502 10:47533976-47533998 GGGATGACCCAGGCTGAGCTGGG + Intronic
1067640611 10:48042080-48042102 GGGATGACCCAGGCTGAGCTGGG + Intergenic
1067872881 10:49978144-49978166 GGGATGACCCAGGCTGAGCTGGG - Intergenic
1070137570 10:73708109-73708131 GGGATGACCCAGGCTGAGCTGGG + Intergenic
1072409849 10:95191644-95191666 GTTCTGTACCAGCATGAGGTGGG + Intergenic
1073070304 10:100789032-100789054 GTGCTGAACCAGGGTCTGGGAGG - Intronic
1074129837 10:110564266-110564288 ATGCTGAATCAATCTGAGGTGGG + Intergenic
1074271915 10:111962416-111962438 GTGTTGATGCAGGCTGAGGGTGG - Intergenic
1075696488 10:124439698-124439720 GGCCTGTGCCAGGCTGAGGTGGG - Intergenic
1075781775 10:125021930-125021952 TTGCTCTACCAGGCTGGGGTAGG + Intronic
1076470379 10:130714310-130714332 GTGCCGTACCAGGCTGGGCTGGG - Intergenic
1078758752 11:14234994-14235016 GTTCTGAACCTGGCTCAGGTGGG - Intronic
1080419299 11:32095800-32095822 GTGCTTCAGGAGGCTGAGGTGGG - Intronic
1080615297 11:33940465-33940487 GGGCTGAAGCAGGGTGGGGTTGG - Intergenic
1081786147 11:45749111-45749133 GTGCTTCAGGAGGCTGAGGTGGG - Intergenic
1084000742 11:66294237-66294259 TTGCTTAACCCGGCTGAGGAAGG - Intronic
1084224314 11:67706137-67706159 GTTCTGAGGGAGGCTGAGGTGGG - Intergenic
1084503074 11:69546336-69546358 GTGCCGACCCTGGCTGAGGGAGG + Intergenic
1084503638 11:69552085-69552107 ATGATAAACCAGGCTGGGGTGGG + Intergenic
1084714198 11:70863358-70863380 TGGATGAACCAGGATGAGGTCGG - Intronic
1085447654 11:76611249-76611271 GTGCTGGCCCAGCCTGAGGCTGG + Intergenic
1086763280 11:90660862-90660884 GTGCTCACCCAGGTTGAGGGTGG + Intergenic
1086839995 11:91673262-91673284 GTGCTGGACCATGCTGTGGTGGG + Intergenic
1086912466 11:92488754-92488776 CTCCTCATCCAGGCTGAGGTGGG - Intronic
1089065331 11:115658448-115658470 GTGCTTAAGGAGGCTGAGGCAGG - Intergenic
1089780706 11:120871495-120871517 TTGCTGAGCTAGGATGAGGTGGG - Intronic
1090381823 11:126332689-126332711 GGGCTGAACCAGGCTGGGGAAGG - Intronic
1091166303 11:133479401-133479423 GTCATGACTCAGGCTGAGGTAGG - Intronic
1091912461 12:4243231-4243253 CTGCTGGACCAGGCTGGGTTGGG - Intergenic
1093784591 12:23177424-23177446 GTGCTGAGCAATGCTGAAGTAGG + Intergenic
1096196380 12:49651412-49651434 GTGCAGCACCAGGGAGAGGTGGG + Exonic
1097277729 12:57824532-57824554 TTCCTGAGCCAGGTTGAGGTTGG - Intronic
1099667623 12:85652723-85652745 GTTCTTAACCAGGCTGAGCTGGG - Intergenic
1100702306 12:97161470-97161492 GGGCTGAAGCAGGGTGAGGAGGG + Intergenic
1101373302 12:104149975-104149997 GTGCTGAGGCAGGCTGAGCCTGG + Intergenic
1101721160 12:107351902-107351924 ATGATGAGTCAGGCTGAGGTAGG + Intronic
1102395855 12:112585209-112585231 GTGCTCACCCAGACTGAGGGTGG + Intronic
1102504440 12:113374783-113374805 GAGCTGCAGCAGGCTGAGGAGGG - Exonic
1103330747 12:120152273-120152295 GTGCTTTAGGAGGCTGAGGTGGG - Intronic
1103555174 12:121761952-121761974 GTGTTGAGCCAGTCTGAGTTAGG - Intronic
1112073131 13:95876630-95876652 GTGCTGTATCAGGTTGAGGAAGG + Intronic
1112900622 13:104352799-104352821 GAGATGAAACAGGGTGAGGTGGG - Intergenic
1114656074 14:24316366-24316388 GTGGTGAACCTGGCTGAGGCGGG + Exonic
1115756288 14:36528629-36528651 GTGCTTTAGGAGGCTGAGGTGGG - Intergenic
1116269518 14:42743048-42743070 GTGCCCACCCAGACTGAGGTTGG + Intergenic
1117133181 14:52706396-52706418 ATGCTGAAGTAGGCTGAGGCAGG - Intergenic
1117597403 14:57337419-57337441 GAGGTGAACCTGGCTGAGCTTGG + Intergenic
1117646501 14:57858845-57858867 GTGCTTTAGGAGGCTGAGGTGGG + Intronic
1118223687 14:63878968-63878990 GTGCTTTGCGAGGCTGAGGTGGG + Intronic
1119340828 14:73876063-73876085 GTACTTAAGGAGGCTGAGGTGGG - Intronic
1119383811 14:74245044-74245066 GTGCTGAGCCAGCCTGGGTTCGG + Intronic
1121406162 14:93720535-93720557 CTGCTGTACCAGGCTGATGCTGG - Exonic
1122490920 14:102115634-102115656 GTACTGTGGCAGGCTGAGGTGGG + Intronic
1123084180 14:105709887-105709909 GGGCTGAGCTAGGCTGAGCTGGG - Intergenic
1123109141 14:105857269-105857291 GTGCTGAACTATGCTTAGCTGGG - Intergenic
1123109186 14:105857514-105857536 GAGCTGAACTGGGCTGAGCTGGG - Intergenic
1123109367 14:105858475-105858497 GTGCTGAGCTAGGCTGGGCTGGG - Intergenic
1123109412 14:105858694-105858716 GAGCTGAACCAGGATGAGCTGGG - Intergenic
1124090427 15:26594760-26594782 GTGCTTTAGGAGGCTGAGGTGGG - Intronic
1124096326 15:26651756-26651778 ATGCTGTACCAGAGTGAGGTTGG - Intronic
1124355315 15:28991170-28991192 GTGCTGAGACAGGCAGAGGAGGG - Intronic
1125479365 15:40069720-40069742 CTGCTGAGCCAGGCTGGTGTTGG + Intergenic
1125722981 15:41853950-41853972 AGGCTGAAGCAGGCTGGGGTGGG + Intronic
1127548195 15:60009806-60009828 GTGCTCAAGAAGGATGAGGTGGG + Intronic
1127816309 15:62612108-62612130 GCACTGAACTAAGCTGAGGTGGG - Intronic
1128968470 15:72085630-72085652 TTTCTGAACTAGGCTGAGATGGG - Intronic
1129034633 15:72641840-72641862 GGGCTGGGCCAGCCTGAGGTTGG - Intergenic
1129215249 15:74095376-74095398 GGGCTGGGCCAGCCTGAGGTTGG + Intergenic
1131604270 15:93884340-93884362 GTGCTGAGCCAAGCTGATTTGGG + Intergenic
1132282749 15:100634414-100634436 GTGCTTAAGCATTCTGAGGTGGG - Intronic
1133001486 16:2853697-2853719 TGGCTGAGCCAGGCTGAGGCTGG + Intronic
1133096265 16:3448502-3448524 GTGCGGAGCCAGCCTGAGTTGGG + Exonic
1134075907 16:11291234-11291256 CTACTCAAGCAGGCTGAGGTAGG - Intronic
1134819379 16:17233876-17233898 GCGCTTAACCAGGATGAAGTTGG - Intronic
1135292430 16:21251350-21251372 GTGCTTTAGGAGGCTGAGGTGGG - Exonic
1135397824 16:22144669-22144691 GTGCTTTAGGAGGCTGAGGTGGG + Intronic
1135763325 16:25155322-25155344 GTGCTTCACAAGGCTGAGGTGGG + Intronic
1136030770 16:27501243-27501265 GTGCGGAACCTGTCTGAGGAAGG - Exonic
1137593580 16:49708826-49708848 GTGCTGAAGCAGGAGGAGGCAGG - Intronic
1141007218 16:80363626-80363648 GTGCTTCACCAGACTGAGGCGGG - Intergenic
1141464258 16:84196030-84196052 GTGCTCACCCAGGATGAGGCTGG - Exonic
1142106063 16:88303466-88303488 GTGCTGCTGCAGGCTGTGGTGGG - Intergenic
1143711188 17:8736385-8736407 GTTCTGGACCAGGCTGGGGGAGG - Intronic
1143849041 17:9795641-9795663 GTGCTTTAAGAGGCTGAGGTAGG - Intronic
1144242303 17:13324670-13324692 GGGCTGAGCCCGGCCGAGGTGGG + Intergenic
1144412351 17:15013410-15013432 GTGCTCACCCAGACTGAGGGTGG - Intergenic
1145743732 17:27297577-27297599 CTGTAGTACCAGGCTGAGGTGGG - Intronic
1146279253 17:31534507-31534529 GTGCTTTGGCAGGCTGAGGTGGG - Exonic
1146323966 17:31869594-31869616 GTGCTTTAGGAGGCTGAGGTGGG - Intronic
1147432206 17:40378978-40379000 GTGCTTTAGGAGGCTGAGGTGGG - Intergenic
1151123570 17:71820229-71820251 GTGCTTCAGGAGGCTGAGGTGGG + Intergenic
1152000384 17:77641593-77641615 GTGCTTTAGGAGGCTGAGGTGGG + Intergenic
1153018869 18:608604-608626 GTGCTTTAGGAGGCTGAGGTGGG + Intronic
1155819688 18:30359728-30359750 CTGCTGAACCAGGTTGAGGTGGG - Intergenic
1157991769 18:52504800-52504822 CTGGAGAAGCAGGCTGAGGTTGG - Intronic
1158451022 18:57565357-57565379 GTGCTTTAGGAGGCTGAGGTGGG + Intronic
1159075696 18:63679359-63679381 GGGCAGATCAAGGCTGAGGTGGG - Intronic
1159162485 18:64661017-64661039 GTGCTCACCCAGACTGAGGGTGG - Intergenic
1160194319 18:76739775-76739797 GTCCTGAACCAGGTTGAGGCGGG + Intergenic
1161100708 19:2419913-2419935 GTGCTTCAGGAGGCTGAGGTAGG + Intronic
1162188074 19:8922690-8922712 GGGGTGGACCAGGGTGAGGTGGG + Intronic
1162879043 19:13643928-13643950 GTGCTGACCAAGGATGAGGTAGG + Intergenic
1165135451 19:33665683-33665705 CTGCTGGACCAGGGTGAGGCTGG + Intronic
1166293618 19:41878495-41878517 GTGCTGGGCCTGGCTGAGGCTGG + Intronic
1167489739 19:49785375-49785397 GTGCTGTGCTAGGATGAGGTGGG + Intronic
1167513222 19:49907952-49907974 AGGCTGAGCCAGGATGAGGTGGG + Intronic
1168561723 19:57390097-57390119 CTGATGAACCTGACTGAGGTGGG + Exonic
925277522 2:2661030-2661052 GTCCTGGACCAGGATAAGGTGGG + Intergenic
925326445 2:3025660-3025682 ATTCTGAACCAGAGTGAGGTTGG - Intergenic
926369576 2:12166391-12166413 GTGCTCACCCAGGTTAAGGTTGG + Intergenic
926563535 2:14444518-14444540 GTGCCCATCCAGGTTGAGGTGGG - Intergenic
927438395 2:23090152-23090174 GTGCCCAACCAGACTGAGGGTGG - Intergenic
927928142 2:27027051-27027073 GTGGTGAACCAGGCTGCTGGAGG - Exonic
928399211 2:30965805-30965827 GTGCTGACCCAGCCTGATGCTGG + Intronic
929026957 2:37614149-37614171 GTGCTGGGCCAGGCTGTGGATGG + Intergenic
931748355 2:65309937-65309959 GGACTGAACCAGGCTGAGCTGGG - Intergenic
931889894 2:66660795-66660817 GTTCTGAACCAGGCTAAGATGGG - Intergenic
933692844 2:85192933-85192955 GTGCTTTATGAGGCTGAGGTGGG - Intronic
933834956 2:86238584-86238606 CTGATGCATCAGGCTGAGGTGGG - Intronic
933864587 2:86504591-86504613 GTGCTTTACAAGGCTGAGGCAGG - Exonic
935075206 2:99735737-99735759 GTGCTTTAGGAGGCTGAGGTGGG - Intronic
935940143 2:108229430-108229452 GTGCTGAGCTAGGCTGATGGTGG - Intergenic
936771784 2:115922380-115922402 ATGCTGGCCTAGGCTGAGGTAGG + Intergenic
937347388 2:121134824-121134846 CTGCTGGACCCGCCTGAGGTAGG - Intergenic
937955259 2:127418593-127418615 GTGCTCAACAAGCCTGAGCTTGG + Intronic
939998200 2:148940152-148940174 GCGCTGAACCAGGGTGGAGTTGG + Intronic
940312726 2:152295232-152295254 AGGCTGAAGCAGGCAGAGGTCGG - Intergenic
941754741 2:169173091-169173113 GTGATGAGCAAGGCTGTGGTAGG - Exonic
942023288 2:171888343-171888365 GTGCTTTGCGAGGCTGAGGTGGG - Intronic
942554226 2:177155176-177155198 GTGCTTAGGGAGGCTGAGGTGGG - Intergenic
944703996 2:202270651-202270673 CTGCTGCAGGAGGCTGAGGTGGG + Intronic
944762355 2:202829550-202829572 GTGCTGCATGAGGCTGAGGCAGG - Intronic
944822391 2:203443896-203443918 GTGAGCAAGCAGGCTGAGGTGGG + Exonic
944842210 2:203635234-203635256 GTGCTGAAACAGCCTGTGTTTGG + Intergenic
946179745 2:217942294-217942316 GGGCTGGACCAGGCTGGGGAGGG - Intronic
946295729 2:218782194-218782216 GGGCTGCGCGAGGCTGAGGTGGG + Exonic
946779794 2:223182251-223182273 GCACTGACCCAGGCTGAGATAGG + Intronic
947389225 2:229622498-229622520 GTGCTGACTCAGGCTGAGGGGGG - Intronic
947474603 2:230431385-230431407 GTGCTGTGCCAGCCTGGGGTAGG + Intronic
947772206 2:232679466-232679488 GTGCTTTAAGAGGCTGAGGTGGG + Intronic
948285319 2:236779871-236779893 GTGCTCACCCATACTGAGGTGGG + Intergenic
948348524 2:237319481-237319503 GTGCCCAAACAGACTGAGGTGGG - Intergenic
948721661 2:239904679-239904701 CTGATGCACCAGGCTGGGGTGGG - Intronic
948792354 2:240385591-240385613 GGGCTGAACTGGGCTGAGCTTGG + Intergenic
948792439 2:240385972-240385994 GAGCTGAACTGGGCTGAGCTTGG + Intergenic
1169880615 20:10342338-10342360 GTGCACAGCCAGGCTGTGGTGGG - Intergenic
1170314814 20:15031070-15031092 GTGCACAGCCAGGCTGTGGTGGG + Intronic
1170973672 20:21140730-21140752 GTGCTTTAGGAGGCTGAGGTGGG + Intronic
1172275715 20:33677904-33677926 GTGCTTCAAGAGGCTGAGGTGGG - Intronic
1175920695 20:62449351-62449373 GTCCTGAGCCAGGGTGAGGCTGG - Intergenic
1176949249 21:15024677-15024699 GAGCTCAAGCAGGATGAGGTTGG + Intronic
1177698835 21:24610107-24610129 GCGCTTAAGGAGGCTGAGGTGGG - Intergenic
1179200367 21:39213149-39213171 GTGCTTTAGCAGGCTGAGATGGG - Intronic
1179272917 21:39865567-39865589 GGGCTGCAGCAGCCTGAGGTTGG - Intergenic
1180616284 22:17130298-17130320 TGGCCGAACCAGGCTGTGGTGGG - Intronic
1181051187 22:20239025-20239047 GTGCTGGACCAGGCAGGGGTTGG - Intergenic
1181082177 22:20423143-20423165 GTGCTGGTCCAGGCTGGGGGAGG + Intergenic
1181117282 22:20640502-20640524 GTGCTTTAAGAGGCTGAGGTGGG + Intergenic
1181413797 22:22745281-22745303 GTGCTTAACCAGGATGGGGAGGG - Intronic
1181611795 22:24019499-24019521 GTGCTCTGCGAGGCTGAGGTGGG - Intronic
1181869766 22:25888506-25888528 GTGCTTTGACAGGCTGAGGTAGG - Intronic
1182554271 22:31120520-31120542 ATGCTGAAACAGGCTGAGGGTGG - Intergenic
1182934641 22:34209507-34209529 GTGCTGCATCAGGTAGAGGTGGG - Intergenic
1183914543 22:41106724-41106746 GTGCAGCTACAGGCTGAGGTGGG - Intronic
1184354439 22:43969554-43969576 GTGCTGTAAGAGGCTGAGGGAGG + Intronic
1184665810 22:45988519-45988541 GTGCTGAGTGAGGCTGAGGCAGG + Intergenic
1184973225 22:48042836-48042858 TGTCTGAACCAGGCTCAGGTCGG + Intergenic
1185165901 22:49261964-49261986 TTCCTGAAACAAGCTGAGGTCGG - Intergenic
949313569 3:2727254-2727276 GTGCTGACCCAGACTCAGCTGGG - Intronic
951182028 3:19669659-19669681 GTGCTGAACCACGTGGAGCTGGG - Intergenic
953014292 3:39058207-39058229 GTGCTTTAGGAGGCTGAGGTGGG - Intronic
953086320 3:39671515-39671537 GTGCTGAACCTGGTTGAGTGAGG - Intergenic
954115551 3:48465181-48465203 GTGCTGGAACAGGCTGCAGTGGG - Intronic
954342988 3:49970746-49970768 GTGCTTTAGGAGGCTGAGGTGGG + Intronic
954692573 3:52403442-52403464 CTGCTGCACCTGGCTGAGGATGG - Exonic
955306581 3:57839183-57839205 GTGCTGTGGGAGGCTGAGGTGGG - Intronic
955697271 3:61649264-61649286 GTACTTTAGCAGGCTGAGGTGGG - Intronic
956789603 3:72670483-72670505 GCGCTTTACAAGGCTGAGGTGGG - Intergenic
958124408 3:89336936-89336958 CTGTTGACCCAGGCTGAGGTGGG + Intronic
959506778 3:107164857-107164879 GTTCAGAACTAGGCTGAGGCTGG + Intergenic
960041213 3:113151602-113151624 CTGCTGAGCCAGGCTGGGGTAGG + Intergenic
960348520 3:116564989-116565011 GTGCTGAAACAGGCTGAAATGGG - Intronic
960725120 3:120662352-120662374 GGTCTGAACCAGGTGGAGGTAGG + Intronic
961025937 3:123557397-123557419 ATACTTTACCAGGCTGAGGTGGG + Intronic
962308360 3:134308680-134308702 GTGCTGAAGCAAGGTGGGGTGGG - Intergenic
962740424 3:138359267-138359289 GTGGTGAACCAGGCTGGAGGTGG - Intronic
963036601 3:141035521-141035543 GTGCTGTAGGAGGCTGAGGCAGG - Intergenic
964428591 3:156579778-156579800 ATTATGAACCTGGCTGAGGTGGG - Intergenic
966341073 3:178925211-178925233 GTTCTTAACCAGGCTAAGGTTGG + Intergenic
967888390 3:194347971-194347993 GGGCTGAACTAGGCAGAGGATGG - Intronic
967888469 3:194348228-194348250 GGGCTGAACTAGGCAGAGGATGG - Intronic
967914608 3:194569345-194569367 GTGGTGCAGGAGGCTGAGGTGGG + Intergenic
968531264 4:1093007-1093029 GTGCTGACGCAGCCTGTGGTAGG + Intronic
968662681 4:1805269-1805291 GGGCTGGGCCAGGCTGGGGTGGG + Intronic
969442237 4:7224218-7224240 GGGCTGAGCCAGGCTGGGGAAGG + Intronic
969673216 4:8601180-8601202 GTGCTGAAGCAGGTTGGGGAAGG - Exonic
970922676 4:21413246-21413268 GAGCTAAGCTAGGCTGAGGTTGG + Intronic
972201420 4:36718094-36718116 GTGTTGAACAAGGATGTGGTGGG + Intergenic
973997808 4:56477537-56477559 GTGCTTTAGGAGGCTGAGGTGGG - Intronic
974000545 4:56506883-56506905 GGGCGGTGCCAGGCTGAGGTGGG - Intronic
974887191 4:67834092-67834114 GAGCTGAAACGGGCTGGGGTAGG + Intronic
978082822 4:104615897-104615919 GTGCTGAGCCATGCAGAGCTGGG + Intergenic
979292411 4:118992290-118992312 CTGCTGAAACAGTCTGAGGAAGG + Intronic
980583849 4:134788270-134788292 GTTCTTAACCAGGTTGAGATGGG - Intergenic
981929422 4:150173775-150173797 GTGCTGCTCCTGGATGAGGTTGG + Intronic
982071467 4:151699097-151699119 GTGCTGAACCAGGCCGGGTGTGG + Intronic
982904514 4:161050599-161050621 GTGCTCACCCAGATTGAGGTGGG + Intergenic
983020065 4:162665306-162665328 GTGCTCACCCAGACTGAGGGTGG - Intergenic
985018585 4:185662838-185662860 GTGCTCAATGAGGCTGAAGTAGG - Intronic
985534908 5:458922-458944 GAGCTGACCCAGGCAGAGGAAGG - Intronic
985984782 5:3505599-3505621 CGGCTGAAGCAGGCTGAGCTGGG + Intergenic
986059411 5:4173862-4173884 GTGCTGAACAAGGTTGAGGGTGG + Intergenic
986164976 5:5265352-5265374 GGGCTGAACCAGGGAGAGCTGGG + Intronic
987859849 5:23470517-23470539 GTTCTGAAGCAGGCAGAGGGTGG + Intergenic
987909479 5:24123055-24123077 ATGAAAAACCAGGCTGAGGTGGG - Intronic
989199460 5:38749275-38749297 GGGCAGAACCAGACTGAGTTTGG + Intergenic
989292523 5:39786440-39786462 GTTCTGAACCAGGCTCTGCTCGG - Intergenic
990181224 5:53162870-53162892 GTGCCCACCCAGGCTGAGGGTGG + Intergenic
991374891 5:65956486-65956508 CTGCAGTCCCAGGCTGAGGTGGG - Intronic
991599732 5:68340484-68340506 GAGATTAACCAGGCTGAGGATGG + Intergenic
992479141 5:77133303-77133325 CTGCTGATTCAGGCTGAGCTTGG - Intergenic
993311590 5:86338881-86338903 GTTCTGAACCAGGCTGAGATGGG + Intergenic
993620558 5:90162866-90162888 GTTCTGATCCAGGCTGAGAATGG + Intergenic
996273436 5:121636618-121636640 GTACTGAATCATGCTGAAGTGGG - Intergenic
996409206 5:123138822-123138844 GTGCTTAACAAGGCTAAGGAAGG - Intronic
996735425 5:126754038-126754060 GTGCTGTGGGAGGCTGAGGTGGG + Intergenic
997290576 5:132730538-132730560 GTGCTTTGCAAGGCTGAGGTGGG + Intronic
998109098 5:139487403-139487425 GTGATGAAGGAGGCAGAGGTTGG - Intergenic
998333853 5:141352741-141352763 GCACTTAACCAGGCTGAGGCAGG + Intronic
998447645 5:142210996-142211018 GTCCTGAATGAGGCTGAGGCCGG - Intergenic
1001289885 5:170449487-170449509 GTCCTGAATCAGGCTGCTGTAGG + Intronic
1002576866 5:180178970-180178992 GGGCTGAAGCAGGATGAGGGAGG + Intronic
1002645988 5:180655143-180655165 GTGCTCACCCAGACTGAGGGTGG - Intergenic
1003114473 6:3274267-3274289 GTGCTGTACCAGGCTGCAGTGGG + Intronic
1003597442 6:7486925-7486947 GTTCTAAAACAGGCTGAGGGCGG + Intergenic
1004928305 6:20436871-20436893 GTGCTGTGGGAGGCTGAGGTGGG + Intronic
1006217361 6:32455910-32455932 GTGCTTTAGGAGGCTGAGGTGGG - Intergenic
1006912988 6:37576100-37576122 GGGCTGGGCCAGGCTGAGGCTGG + Intergenic
1008820766 6:55628548-55628570 GGGCTGAAAGAGGCCGAGGTGGG - Intergenic
1009312444 6:62171108-62171130 GTTCTTAACCAGGCTGAACTGGG + Intronic
1009678127 6:66854355-66854377 GTGCCCAATCAGACTGAGGTTGG - Intergenic
1010447076 6:75960159-75960181 GAGCTGAAGCAGGGTGGGGTGGG - Intronic
1011438962 6:87368044-87368066 GTGCTTTAGGAGGCTGAGGTGGG + Intronic
1011612208 6:89163589-89163611 GTGCTTTAGGAGGCTGAGGTGGG - Exonic
1012258286 6:97059123-97059145 GTGGAGACCCAGGATGAGGTAGG + Intronic
1012597986 6:101062324-101062346 CTGCTGAGCCAGGCTTAGGAGGG - Intergenic
1013364843 6:109429265-109429287 GTGCAGAAGCAGGCTGGAGTAGG - Intronic
1016435761 6:144035513-144035535 GTGCCCAACCAGACTGAGGGTGG + Intronic
1017724833 6:157269633-157269655 GTGGTAAACCAGGCTGAGCTCGG + Intergenic
1017944357 6:159081623-159081645 GTGATGAGCCAGGCAGAGTTTGG - Intergenic
1018221604 6:161586262-161586284 GTGCTGTGGGAGGCTGAGGTGGG - Intronic
1019850040 7:3545663-3545685 ATGCTGAACCAGCCAGAGGATGG - Intronic
1020127851 7:5542900-5542922 GGGCTGGTCCAGGCTCAGGTGGG + Intronic
1021098354 7:16559145-16559167 GTGCTTAGGCAGGCTGAGGTGGG + Intronic
1021982899 7:26071837-26071859 GTGCTGAATCAGGCAAATGTGGG - Intergenic
1025061414 7:55811743-55811765 GTGCTTTAGGAGGCTGAGGTGGG - Intronic
1026734500 7:72941098-72941120 GTGCTGAGCCAGGGTGCGTTCGG - Intronic
1026784834 7:73296006-73296028 GTGCTGAGCCAGGGTGCGTTCGG - Intergenic
1027109242 7:75423922-75423944 GTGCTGAGCCAGGGTGCGTTCGG + Intronic
1027938991 7:84648570-84648592 ATGCTGATCTAGGCTGAGCTAGG + Intergenic
1032890610 7:136191167-136191189 GTGCCCACCCAGACTGAGGTTGG + Intergenic
1033623791 7:143088442-143088464 GAGCTGAAGCAGGGTGAGGCAGG + Intergenic
1033653872 7:143361193-143361215 GTGGTGAACCGGACTGAGGAGGG + Intronic
1034344323 7:150376879-150376901 GTGATGAACCAGGCAGAGCAAGG - Intronic
1035548654 8:503123-503145 GTGTTGACACATGCTGAGGTGGG - Intronic
1037166168 8:15831434-15831456 GTTCTGAACTCGGCTGAGATGGG + Intergenic
1037504199 8:19514572-19514594 GTGCTTAGGGAGGCTGAGGTGGG + Intronic
1037812729 8:22096526-22096548 GCGCTGGGCCAGGCCGAGGTGGG + Intronic
1037812748 8:22096592-22096614 GCGCTGGGCCAGGCCGAGGTGGG + Intronic
1037812758 8:22096626-22096648 GTGCTGGGCCAGGCTGAGGTGGG + Intronic
1038181419 8:25232308-25232330 ATGCAGAACAAGGCTGAGCTAGG + Intronic
1039471346 8:37815440-37815462 GCTCTGAACCAGGGTGGGGTGGG - Intronic
1039966141 8:42285297-42285319 GTGCTTAGAGAGGCTGAGGTAGG + Intronic
1040594359 8:48823095-48823117 ATGCTGAACCAGGGTCAGGCAGG + Intergenic
1040959416 8:53015356-53015378 GAGCAGCACCAGTCTGAGGTTGG - Intergenic
1043383792 8:79729538-79729560 GTCCTGAACCAAGCTGGAGTTGG - Intergenic
1051547461 9:18292542-18292564 GTGCCCACCCAGGCTGAGGGAGG - Intergenic
1052961003 9:34296423-34296445 AGGCTGAGGCAGGCTGAGGTAGG + Intronic
1055128640 9:72749566-72749588 GTGCTGGGCTGGGCTGAGGTAGG + Intronic
1056380950 9:86056910-86056932 GTGCTGCAGGAGGCTGAGGCAGG - Intronic
1057307541 9:93920977-93920999 GGGCTGAAGGAGTCTGAGGTGGG - Intergenic
1057337092 9:94164813-94164835 ATGATGAAGTAGGCTGAGGTGGG - Intergenic
1057485575 9:95480472-95480494 ATGCTGAATAAGGCTGAGGTTGG - Exonic
1058490924 9:105498089-105498111 GTGCTTTAGAAGGCTGAGGTGGG - Intronic
1058649800 9:107164641-107164663 GTGCCCACCCAGGTTGAGGTGGG - Intergenic
1058967837 9:110053692-110053714 GTCCTTAACCAGGCAGAGGTTGG + Intronic
1060134736 9:121142391-121142413 GTGCTGAACCTGACCTAGGTGGG + Intronic
1060371594 9:123078608-123078630 GTGCTGAACCAGGCTGAGGTGGG - Intronic
1060487910 9:124061202-124061224 GAGCTGCACCAGGAAGAGGTAGG - Intergenic
1060761669 9:126257181-126257203 GTGCTTTAGGAGGCTGAGGTGGG + Intergenic
1060862495 9:126966270-126966292 GTGCTGTGGGAGGCTGAGGTAGG + Intronic
1061254002 9:129443175-129443197 GTGCTGCAGGAGGCTGAGCTTGG + Intergenic
1061297818 9:129686621-129686643 GTGCTTTAGGAGGCTGAGGTGGG - Intronic
1062245844 9:135565652-135565674 GTGCAGAGCCACCCTGAGGTGGG + Intronic
1185696909 X:2201911-2201933 GTGCTTCAGGAGGCTGAGGTGGG - Intergenic
1186172356 X:6890850-6890872 GTGCTTTGACAGGCTGAGGTGGG + Intergenic
1187098254 X:16168569-16168591 GTTCTGAACCTGGCTCAGGGTGG - Intronic
1187384554 X:18835987-18836009 GTGCTTTAGGAGGCTGAGGTGGG - Intergenic
1187942369 X:24394470-24394492 GGTCTGGACCAGGCTGTGGTAGG + Intergenic
1188670628 X:32877850-32877872 CTGCAGAACCAGACTGAGGCTGG + Intronic
1189122880 X:38413918-38413940 GTGCTTTTCGAGGCTGAGGTGGG - Intronic
1189254124 X:39624158-39624180 GTGCTCCAGCAGGCTCAGGTGGG - Intergenic
1191852449 X:65595491-65595513 GGCCAGAATCAGGCTGAGGTAGG - Intronic
1192753442 X:74019203-74019225 GTTCTTAACCAGGCTGAGATGGG + Intergenic
1192776461 X:74250778-74250800 GTGCTTTAGGAGGCTGAGGTGGG + Intergenic
1195148965 X:102045592-102045614 GTTCTTAACCAAGCTGAGCTGGG + Intergenic
1195246286 X:102998542-102998564 GTGCTGAACCAGGTGGAAGGGGG - Intergenic
1197871381 X:131065742-131065764 GTGCTGACCCAGGCCCAGCTGGG + Intronic
1198312278 X:135434823-135434845 GCGCTGACCAAGGCTGAGGCTGG + Intergenic
1199191852 X:144980436-144980458 GTGGTGAACGATGCTGAGCTTGG - Intergenic
1199720787 X:150541593-150541615 GTGCTGCCACAGGCTTAGGTTGG - Intergenic
1200247976 X:154535898-154535920 GGGCAGAACCAGGCTGGGGGAGG + Intronic
1201396203 Y:13551956-13551978 GTGCTGTGGGAGGCTGAGGTGGG + Intergenic
1201525837 Y:14933308-14933330 GTGCTCAACCAAGCTGATTTTGG - Intergenic
1202602925 Y:26612959-26612981 GTGATGAAGCAGGCAGATGTTGG - Intergenic