ID: 1060371983

View in Genome Browser
Species Human (GRCh38)
Location 9:123082417-123082439
Sequence CAGTTGTATGAAAGGGCTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 160
Summary {0: 1, 1: 0, 2: 3, 3: 13, 4: 143}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060371983_1060371987 -1 Left 1060371983 9:123082417-123082439 CCCACAGCCCTTTCATACAACTG 0: 1
1: 0
2: 3
3: 13
4: 143
Right 1060371987 9:123082439-123082461 GCACCTTGCATAGTCTTTAGAGG No data
1060371983_1060371991 13 Left 1060371983 9:123082417-123082439 CCCACAGCCCTTTCATACAACTG 0: 1
1: 0
2: 3
3: 13
4: 143
Right 1060371991 9:123082453-123082475 CTTTAGAGGGGAATATTGAAAGG No data
1060371983_1060371989 1 Left 1060371983 9:123082417-123082439 CCCACAGCCCTTTCATACAACTG 0: 1
1: 0
2: 3
3: 13
4: 143
Right 1060371989 9:123082441-123082463 ACCTTGCATAGTCTTTAGAGGGG No data
1060371983_1060371988 0 Left 1060371983 9:123082417-123082439 CCCACAGCCCTTTCATACAACTG 0: 1
1: 0
2: 3
3: 13
4: 143
Right 1060371988 9:123082440-123082462 CACCTTGCATAGTCTTTAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060371983 Original CRISPR CAGTTGTATGAAAGGGCTGT GGG (reversed) Intronic
901165512 1:7218838-7218860 CAGTCGTGTGAAAGGTGTGTGGG + Intronic
901550216 1:9990435-9990457 GAGGAGTTTGAAAGGGCTGTTGG - Intergenic
909277007 1:73699618-73699640 CAGTTGGTTGAGAGGACTGTTGG - Intergenic
909537330 1:76752032-76752054 CAGTTGGATGAAAGGAGAGTAGG - Intergenic
916323534 1:163532656-163532678 GAGTTGTGTAAAAGGGCTATGGG - Intergenic
920872863 1:209808401-209808423 CAGGTGTATGAGAGGGATGAGGG + Intergenic
922193237 1:223338351-223338373 CAGTTGTACTAAATGGCTGAAGG - Intronic
924066987 1:240233988-240234010 CAGATGGATGAAAGGGATGTTGG + Intronic
1065705429 10:28467867-28467889 GCATTGTATTAAAGGGCTGTTGG - Intergenic
1068161544 10:53271591-53271613 CAGTTGTATAAGGGGGCTGAAGG - Intergenic
1069598637 10:69688877-69688899 CAGATGTCTGTAAGGGATGTTGG - Intronic
1069702900 10:70439606-70439628 CAGTTGCATGAAAGGGATGTTGG - Intronic
1070217592 10:74403126-74403148 CAGTTGTATGAGGTGTCTGTTGG + Intronic
1070638867 10:78151671-78151693 GAGGTGTATGAATGGGCTGTGGG - Intergenic
1073838497 10:107471404-107471426 CAGTTCTATGCAAAGGCTGGAGG + Intergenic
1075571955 10:123552630-123552652 CAGTTGTATGAGGAGGCTGGGGG + Intergenic
1076386743 10:130062566-130062588 CAGTGGTTTGCAAGGGCTGTTGG + Intergenic
1076576255 10:131471539-131471561 CCATAGTATCAAAGGGCTGTGGG - Intergenic
1080169362 11:29281166-29281188 CAGTTTAATTAAAGGGCTATTGG + Intergenic
1081947039 11:47006099-47006121 AAGCTGTATGAAATGGATGTGGG - Intronic
1085313563 11:75530257-75530279 CTGATGTATAACAGGGCTGTAGG + Intergenic
1086306170 11:85483446-85483468 CTCTTGTAAGATAGGGCTGTTGG - Intronic
1086978072 11:93160495-93160517 CAGATGTAGAAAGGGGCTGTGGG + Intronic
1086989741 11:93289925-93289947 CAGTTATATCAAAGGGCAGGAGG + Intergenic
1089093125 11:115895205-115895227 CAGTTGTATGAATGGGAGGAAGG - Intergenic
1090055657 11:123422145-123422167 CATTTGTAGGAGAGGGATGTGGG + Intergenic
1096045259 12:48556697-48556719 CAGGTGTATGAAGAGGCTGGAGG + Intergenic
1101265837 12:103086164-103086186 CAGTTGTCTCAAATGGATGTTGG - Intergenic
1109371874 13:61432667-61432689 CATTTGTATAATAGGGCAGTTGG + Intergenic
1111481006 13:88826116-88826138 CAGTTGTATGAAAAAGCTGTAGG - Intergenic
1113484262 13:110642766-110642788 GAGTTGGAAGAAAGGGCTGGGGG + Intronic
1116499948 14:45608346-45608368 CAGGTGCCTGAAAGGGCTCTTGG - Intergenic
1117215357 14:53545932-53545954 CTGTTGTATGAATGGCCTATAGG + Intergenic
1117303419 14:54450251-54450273 ATGTTTTATGAAAGGGCTGGAGG - Intergenic
1119007687 14:70946434-70946456 CAATTGTATGATAAGGCTTTTGG + Intronic
1119590577 14:75883822-75883844 GAGTAGTAGGAAAGGGCAGTAGG + Intronic
1121038385 14:90725568-90725590 AAGTGGTATGGAAGGGCTTTTGG - Intronic
1126273349 15:46847916-46847938 CAGTTGTTTGAAGTGGCTATGGG + Intergenic
1126831909 15:52616348-52616370 CAGTTGTCTGAAAGAACTTTAGG + Intronic
1132034383 15:98469111-98469133 CACTCCTATGAAAGGGCTGGAGG + Intronic
1133406364 16:5527685-5527707 CAGACTTAGGAAAGGGCTGTGGG + Intergenic
1136083488 16:27868112-27868134 CATTTGTATGAAAGGCCTGATGG + Intronic
1136393163 16:29977966-29977988 GAGTAGTGTGCAAGGGCTGTTGG - Intronic
1141221142 16:82070325-82070347 CAGTGGTAGGAAGGGGCTGGAGG - Intronic
1143047696 17:4095325-4095347 CAGTGTTATGAATGTGCTGTAGG - Intronic
1144509739 17:15865644-15865666 AAGTTGTAGGAAAGGTCTGTGGG - Intergenic
1145173849 17:20683288-20683310 AAGTTGTAGGAAAGGTCTGTGGG - Intergenic
1150939850 17:69680871-69680893 CAGTAGTATCAGAAGGCTGTTGG + Intergenic
1157990232 18:52487026-52487048 CAGTTTTATTTAAAGGCTGTGGG - Intronic
1158939018 18:62389690-62389712 CAGTTTTATGAATGGGATGAAGG - Exonic
1159226674 18:65546857-65546879 CAGTTGTTTGAAAAGCCTCTAGG + Intergenic
1159484738 18:69041545-69041567 AAGTTGAATGGAAGGGCTTTGGG - Intronic
1162817696 19:13206432-13206454 AAGTTGAATCAAAGGGCTTTTGG - Exonic
1164808295 19:31135619-31135641 CTGTTGTATGAAAGACCTTTAGG - Intergenic
1164872929 19:31661614-31661636 CAGGTGTATGAAAAGGCACTCGG + Intergenic
1165326481 19:35117152-35117174 CTGTTGTCTGAAGAGGCTGTGGG - Intronic
1167611276 19:50508801-50508823 CTTTTGTATGAAAGAGCTGATGG + Intronic
928188186 2:29134636-29134658 CAGTTGTAGGAAGGGTATGTGGG + Intronic
928775136 2:34751754-34751776 CAAATGTATGAAAGTGCTGTCGG - Intergenic
932086913 2:68770716-68770738 TAGTTGTATGACTGGACTGTTGG - Intronic
932948338 2:76263096-76263118 GAGTTCTATGAAATGGCTGTGGG + Intergenic
934942170 2:98510601-98510623 GTGCTGTATGAAAGGGCTGGAGG - Intronic
938949901 2:136246024-136246046 AAGTTGTGGGACAGGGCTGTTGG + Intergenic
940332620 2:152491435-152491457 CAGTTTTGTGAAAGGACAGTGGG + Intronic
943930396 2:193843788-193843810 GAGTTCTATGAAAGTGCTCTGGG + Intergenic
945346418 2:208723391-208723413 AACTTGGATGTAAGGGCTGTAGG + Intronic
946555831 2:220856088-220856110 CCCTTTTATGAAAGGGTTGTAGG + Intergenic
1170173928 20:13446092-13446114 CAGTTGTATGACAGGTATGGAGG + Intronic
1170610365 20:17907791-17907813 CAGCCTTATGAAAGGGCTGGAGG - Intergenic
1174743017 20:53034299-53034321 CAGCTGCATTAAAGGGTTGTTGG + Intronic
1175271444 20:57736822-57736844 CATTTGTTTGAAAGTCCTGTGGG + Intergenic
1178515147 21:33240129-33240151 CAAATGTGTGAGAGGGCTGTAGG - Intronic
1178614584 21:34120335-34120357 CAGCTGTATGAAAATGCAGTGGG - Intronic
1179670507 21:42943612-42943634 CAGCTGAAGGAAAGGTCTGTAGG - Intergenic
1182192539 22:28477782-28477804 CAGTTGTACGAGAGGGCAGGTGG - Intronic
1182318736 22:29464670-29464692 CAGTTGTAGAGAAGGGCAGTGGG - Intergenic
949719678 3:6974336-6974358 CAGTTGAGTGAAAGGGTTCTGGG + Intronic
951788198 3:26448027-26448049 TAGTTGAATAAAATGGCTGTAGG - Intergenic
952450236 3:33425093-33425115 CAGTGATATGAAAGGGTTGGTGG - Intronic
953247763 3:41211091-41211113 CAGTTGTATAAAAGTACAGTGGG - Intronic
954670809 3:52290460-52290482 CAGCTGTTTGAGAGTGCTGTAGG + Exonic
955114403 3:55983031-55983053 CTGTTTGATGAAGGGGCTGTTGG - Intronic
956739869 3:72267347-72267369 CAGTTGTCTGAAAAACCTGTGGG - Intergenic
956982879 3:74660273-74660295 CTGTTGTAGTAAAGGCCTGTTGG - Intergenic
959151660 3:102615633-102615655 CATTTGTCTGAAATGTCTGTAGG - Intergenic
960719967 3:120616233-120616255 CAGTTTTATGAATAGGCTGGAGG + Intergenic
963591808 3:147269954-147269976 CAGTTGTATGACTTGGCTCTTGG + Intergenic
966503546 3:180673749-180673771 CAGTTGTAAAACAGGCCTGTGGG + Intronic
966645204 3:182238440-182238462 CAGCTGTATTAAGGGGCCGTTGG + Intergenic
967909443 3:194529106-194529128 CAACTGGATGAAAAGGCTGTGGG + Intergenic
968445160 4:648775-648797 AAGCTGCATGAAAGGCCTGTGGG + Intronic
969937485 4:10696589-10696611 CAGTGGGCTGTAAGGGCTGTAGG + Intergenic
969956248 4:10894008-10894030 CAGGGGTATGCAAGGGCAGTGGG - Intergenic
971092189 4:23358990-23359012 CAGTTCTCTGAAAGATCTGTTGG - Intergenic
971424613 4:26503475-26503497 CAGTGGTATGGAAGGGCACTGGG - Intergenic
974009038 4:56590536-56590558 CAGTTATCTGAAAAGGCTCTTGG + Intronic
976712039 4:88082863-88082885 AATTTGTATAAAAGGTCTGTAGG + Intergenic
976892358 4:90065296-90065318 CATTTGTCAGCAAGGGCTGTAGG + Intergenic
976895629 4:90107487-90107509 TAGTAGTATTAAAAGGCTGTTGG + Intergenic
977849298 4:101805939-101805961 AAGTTATATTAAAAGGCTGTAGG - Intronic
978044652 4:104111799-104111821 CTGTAGTATGAAAGGTCTTTAGG + Intergenic
980344274 4:131592633-131592655 AAGTTGTATGATAGAGCTGATGG + Intergenic
984420162 4:179511532-179511554 CTGTTTTATGAAAGGGGTGCTGG + Intergenic
984619742 4:181938869-181938891 CAATTTTGTGAAAGGGCTTTTGG + Intergenic
986454971 5:7909059-7909081 CAGTAGTATGAGAAGGCTGGGGG + Intergenic
986480764 5:8184685-8184707 CACTTGGATGAGAGGGCTGGTGG - Intergenic
988247661 5:28708366-28708388 CATTTGTAAGAAAGGACTCTGGG + Intergenic
988714137 5:33808200-33808222 CAGTTTTCTGAAATGGCTGTGGG + Intronic
991982931 5:72251966-72251988 AAGTTGTCTGAAAGAGCTGATGG - Intronic
992091295 5:73319692-73319714 CTGTGGTATGAAAGGTCTGGTGG - Intergenic
992973193 5:82083589-82083611 CAGTTGTATGAGGGGTCAGTTGG - Intronic
996024201 5:118625665-118625687 CAGTTGTAAGAAAAAACTGTTGG - Intergenic
996316285 5:122164367-122164389 CTGTTGGTTGAAATGGCTGTTGG + Intronic
998352202 5:141508954-141508976 CAGCGGAATGAAAGGGCTGGGGG + Intronic
999100758 5:149024026-149024048 CAGTGTTCTCAAAGGGCTGTTGG + Intronic
1000297139 5:159921784-159921806 CATTTGAATGAAAGGGCTGGAGG - Intronic
1001097170 5:168784619-168784641 AAGATGTAAGAAAGGGCTGGAGG + Intronic
1003442800 6:6159233-6159255 AAGTTGTATGAATGGGATGTGGG + Intronic
1003978529 6:11367196-11367218 CAGTGGTCTGAAAGTGCAGTGGG + Intronic
1006192644 6:32219154-32219176 CTGTTGTATCACAGGGCTTTTGG + Intronic
1010932330 6:81818071-81818093 CTGTTGTAAGAATGGGCAGTAGG - Intergenic
1013169207 6:107620882-107620904 CAGTTGTATGAAGGGTCAGATGG + Intronic
1013649805 6:112182963-112182985 AAGTGGTGGGAAAGGGCTGTAGG + Intronic
1014296434 6:119624215-119624237 CAGTAAAATGAAAGGCCTGTTGG + Intergenic
1015093391 6:129385479-129385501 CAGTTGTAATAAATTGCTGTGGG + Intronic
1015155554 6:130091507-130091529 CCATTGTGTGAAAGGGCAGTTGG - Intronic
1015352362 6:132236381-132236403 CAGTTCTTTGAAAGGGCAATAGG - Intergenic
1015822329 6:137277575-137277597 CAGTGCTATGAAAGTTCTGTAGG - Intergenic
1018505778 6:164466848-164466870 CAGTTGTATGCAAGCCTTGTTGG - Intergenic
1018522884 6:164671273-164671295 CAGCTGGATGAAAGGTGTGTGGG + Intergenic
1024827268 7:53405962-53405984 CAGTCTTATAAAAGGGCTGGAGG + Intergenic
1024928434 7:54643077-54643099 CAGATGTCTGAAGGGGCTTTGGG + Intergenic
1025241795 7:57282959-57282981 CAGTTATATGAAAGGCTGGTAGG + Intergenic
1030266865 7:107630111-107630133 CAGTTGTATGATAGGTTGGTAGG + Intergenic
1032214852 7:129949975-129949997 CAATTGTGTGAAAAGGCTGGGGG - Intronic
1034839712 7:154384414-154384436 CACTTGAATGAAAAGGATGTGGG + Intronic
1035161852 7:156956593-156956615 CAGCTTTTTGAAAGGCCTGTGGG + Intronic
1035585819 8:772724-772746 CAGGTGTTTGAGAGGGATGTGGG + Intergenic
1035839390 8:2794611-2794633 AAGTTGTATTAAAGTGCTGAAGG + Intergenic
1037683591 8:21118929-21118951 CAGTTGTATGCTAGGTTTGTAGG - Intergenic
1039713865 8:40087733-40087755 CAGTTATATGAAGAGGCTGGAGG - Intergenic
1041392485 8:57359452-57359474 AAGTTGTATGAAATGCCTTTGGG - Intergenic
1042658909 8:71132629-71132651 CTGTTGTATGAGAGAGCTGTTGG + Intergenic
1044342929 8:91068935-91068957 CAATTGTATGAAAGAACTGATGG - Intergenic
1046581284 8:116095499-116095521 CAGTCGTCTCAAAGAGCTGTAGG + Intergenic
1048268524 8:133009201-133009223 AAGTTCTATGAAAGGGTTTTAGG - Intronic
1048293565 8:133198363-133198385 CAGTTGTATGAGGCTGCTGTGGG - Intronic
1053679738 9:40477341-40477363 ATGTTGTATGAAAGAGCAGTTGG + Intergenic
1053929731 9:43105673-43105695 ATGTTGTATGAAAGAGCAGTTGG + Intergenic
1054292819 9:63312877-63312899 ATGTTGTATGAAAGAGCAGTTGG + Intergenic
1054294874 9:63325888-63325910 CACATGTTTGAGAGGGCTGTGGG - Intergenic
1054504884 9:65898957-65898979 ATGTTGTATGAAAGAGCAGTTGG - Intergenic
1054958963 9:70945829-70945851 AAGTTGTAAGAACTGGCTGTGGG + Intronic
1055836167 9:80445476-80445498 CAGTGTTTTGACAGGGCTGTTGG - Intergenic
1060371983 9:123082417-123082439 CAGTTGTATGAAAGGGCTGTGGG - Intronic
1191714372 X:64184247-64184269 CAGTTGCTTGAAAGTGCTGTGGG - Intergenic
1191715959 X:64193681-64193703 CAGTTGTGTGAAAGGCCTAGTGG + Intronic
1198492332 X:137154296-137154318 CAGTTGTATGAAAGAGCTGAAGG + Intergenic
1199600612 X:149539482-149539504 TAGTTGTGGGAAAGAGCTGTGGG - Intergenic
1199649942 X:149940363-149940385 TAGTTGTGGGAAAGAGCTGTGGG + Intergenic