ID: 1060374116

View in Genome Browser
Species Human (GRCh38)
Location 9:123103264-123103286
Sequence ATCACACATCTGGCCAAAGA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 236
Summary {0: 1, 1: 0, 2: 2, 3: 10, 4: 223}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060374116_1060374118 -5 Left 1060374116 9:123103264-123103286 CCTTCTTTGGCCAGATGTGTGAT 0: 1
1: 0
2: 2
3: 10
4: 223
Right 1060374118 9:123103282-123103304 GTGATTCTGTGACTTGTCCCAGG 0: 1
1: 0
2: 4
3: 24
4: 248

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060374116 Original CRISPR ATCACACATCTGGCCAAAGA AGG (reversed) Exonic
902871815 1:19318219-19318241 GTCACACAGCTGGTCAGAGATGG + Intronic
905044648 1:34986027-34986049 ATCAGACATCTGGCCAAATTTGG - Intronic
905652160 1:39663735-39663757 AGCAGACATCTGGCCCAAGCTGG + Intronic
912179390 1:107200064-107200086 AGTACATATCTGGCTAAAGAAGG - Intronic
912713802 1:111967860-111967882 GTCACACAGCTTGCCAAAGCTGG + Intronic
912882765 1:113434061-113434083 ATCACAAATCAGGGCAATGAAGG - Intronic
913938357 1:125078475-125078497 ACCACACATAGGACCAAAGAAGG - Intergenic
914793876 1:150903507-150903529 ATCACCCTTCTGGCCAGACATGG + Intergenic
918004952 1:180533293-180533315 ATCACACATATTTCCAAAGGAGG + Intergenic
918619042 1:186581432-186581454 ATAACAAATTTGGCCAAACATGG - Intergenic
919151765 1:193710147-193710169 ATCACACAGCTGGGCAGAGGTGG + Intergenic
919545560 1:198913675-198913697 AGCAAATATATGGCCAAAGAAGG + Intergenic
920692443 1:208157359-208157381 ATCTCACTTCTTTCCAAAGAAGG - Intronic
922184031 1:223258323-223258345 ATTTCACATTTGGCCAAACAAGG + Intronic
923804177 1:237240198-237240220 ATAACTCTTCTGGCAAAAGAGGG - Intronic
924727817 1:246686498-246686520 GTCACATAGCTGGCCCAAGATGG - Intergenic
1063264681 10:4434658-4434680 ATAAAACATCTGACCTAAGAGGG - Intergenic
1065700467 10:28420478-28420500 CTCACACATTTGGCCATAGAGGG - Intergenic
1066504141 10:36024433-36024455 CACACACATCTGGTCACAGAAGG - Intergenic
1067498360 10:46779021-46779043 ATTACACATTTGGCCCAACATGG + Intergenic
1067596288 10:47561394-47561416 ATTACACATTTGGCCCAACATGG - Intergenic
1070941559 10:80353011-80353033 ATCACACAGCTGGCAGATGAAGG + Intronic
1070941651 10:80353672-80353694 ATCACACAGCTGGCAGATGAAGG - Intronic
1070992743 10:80746639-80746661 ACCACACATCTGCTCAAGGACGG - Intergenic
1071434378 10:85633319-85633341 ATCTCACAGCTGGTAAAAGATGG + Intronic
1071649246 10:87379667-87379689 ATCAGACTTCAGGCCAAAGCTGG + Intergenic
1072283636 10:93893289-93893311 ATCTTACATCTGGCCAAATTAGG + Intergenic
1072550125 10:96470943-96470965 ATCACAAAGTTGGCCAGAGAGGG - Intronic
1073529318 10:104216811-104216833 ATCACACACCCTGCTAAAGATGG + Intronic
1074187901 10:111112979-111113001 ATCACACAGCTGGACATAGAAGG - Intergenic
1074853892 10:117459272-117459294 ATCTCCCATTTGGACAAAGAGGG - Intergenic
1077499532 11:2902905-2902927 ATCAGCCCTCTGGCCACAGAAGG + Intronic
1080466966 11:32506796-32506818 ATCGAACCTCTGGCTAAAGAAGG - Intergenic
1080575023 11:33590676-33590698 ATCACAGATCTGAACACAGAGGG - Intronic
1080653076 11:34237971-34237993 ATCACACATCAGGGCAAATGGGG - Intronic
1080989953 11:37519819-37519841 ATCACACATCATGACAAAGTTGG + Intergenic
1081082405 11:38758377-38758399 AACCCACATCTGGCCAAAAAAGG + Intergenic
1083031032 11:59592605-59592627 AGCACACACTTGGCCAAACATGG + Intronic
1083067519 11:59940379-59940401 AACTCACATATGGGCAAAGAGGG - Intergenic
1083295851 11:61715348-61715370 ATTTCCCATCTGGCCAGAGATGG - Intronic
1084197717 11:67533797-67533819 AGCAAACATGTGGCCAAAAAAGG - Intergenic
1085551831 11:77380773-77380795 AGCACACACCTGGACAAAGTAGG + Intronic
1087669675 11:101090488-101090510 ATCACACATCTAGTCAATGTCGG - Intronic
1087973716 11:104517752-104517774 ATCCAACATCTGGCCATAGTCGG + Intergenic
1088185477 11:107162961-107162983 ATCAAACATCTGATCCAAGATGG - Intergenic
1089432916 11:118437332-118437354 GTAACACATCTGCCCAGAGAGGG - Intronic
1090462985 11:126908397-126908419 GTCACACAGCTGGTCAGAGATGG - Intronic
1092149172 12:6235517-6235539 CTCAGACATCTGCCCCAAGAAGG + Exonic
1094494204 12:30979335-30979357 ATCACACCTCTGCCCTAAGTTGG + Intronic
1095718776 12:45377389-45377411 ATAACGTATCTGGCCAAATAAGG - Intronic
1098345536 12:69499014-69499036 ATGACACAGCTGGCAAATGATGG + Intronic
1101635597 12:106538350-106538372 ATCAAACAGCTTTCCAAAGATGG - Intronic
1102416921 12:112771534-112771556 TTCAAACATATGCCCAAAGATGG - Intronic
1103894257 12:124262580-124262602 GCCACACAGCTGGCTAAAGATGG - Intronic
1104133262 12:125915017-125915039 TTCCCTCACCTGGCCAAAGAGGG + Intergenic
1104675371 12:130708927-130708949 ATCACACAGCTGGGGAGAGATGG - Intronic
1105870590 13:24502750-24502772 ATTACTCATCTGTCCAGAGATGG + Intronic
1109063035 13:57644593-57644615 TTCACACATCTGCCCAAGGGGGG - Intronic
1110087818 13:71404531-71404553 ATCTAACATCTGGACAAAGGAGG - Intergenic
1110153496 13:72284438-72284460 ATCACACAGCTGGGCAATGTTGG - Intergenic
1110513299 13:76379236-76379258 ATCTGACATCTGGTTAAAGACGG + Intergenic
1110984297 13:81944577-81944599 TCCACACATCTGGCTAAAAAAGG + Intergenic
1113284207 13:108828726-108828748 TTCAAACATGTGGCCAATGATGG + Intronic
1114713500 14:24802086-24802108 ATAACACAGCAGGGCAAAGAAGG + Intergenic
1114827060 14:26093875-26093897 ATCACACATGTGGCCATATGAGG + Intergenic
1115826940 14:37289232-37289254 ACTACACATTTGGCCAAAAAAGG - Intronic
1117032030 14:51682863-51682885 AACTCACAGCTGGCCAAACAGGG - Intronic
1117568146 14:57017624-57017646 ATCTCACATGTGGCAAAACATGG - Intergenic
1117839163 14:59840418-59840440 ATCACACAACTGAAAAAAGAAGG - Intronic
1118699690 14:68421233-68421255 ATCACACATGTGGCTAAAGCAGG + Intronic
1118866483 14:69708425-69708447 ATCACACAGCTGGTAAAGGATGG - Intronic
1120149146 14:81013754-81013776 ACCACACATGTGGCCCAAGGAGG + Intronic
1126300679 15:47192525-47192547 ACAATACATCTGCCCAAAGATGG + Intronic
1130108524 15:80946740-80946762 CCCACACATCTGGCCACAGTTGG - Intronic
1130237660 15:82151802-82151824 CTCACACATGGGGCCAGAGAGGG + Exonic
1131612516 15:93979887-93979909 ATTACACAGCTGGCCAGAAATGG - Intergenic
1131920637 15:97324226-97324248 AGCAAACATCTGGGCATAGAAGG + Intergenic
1143886400 17:10068156-10068178 ATCACACAGCACCCCAAAGAGGG + Intronic
1144356359 17:14450343-14450365 ATCACACAGCTGGCAAATCATGG + Intergenic
1146209909 17:30934004-30934026 ATCACAAAGTTGGCCACAGATGG + Intronic
1146482368 17:33214940-33214962 GTCACACAGCTGGCAAAAGGAGG + Intronic
1149397218 17:56257442-56257464 CTCATACATCTGGAAAAAGAGGG + Intronic
1149796613 17:59526880-59526902 ATCACACAATTGGTCAAGGAGGG - Intergenic
1155807101 18:30185094-30185116 ATAAAATATCTGGCCAGAGATGG + Intergenic
1157131491 18:45011777-45011799 ATCACACAGCTGGACAGAGGTGG - Intronic
1159734854 18:72082988-72083010 ATCACATATTTTGCCAAATAGGG - Intergenic
1161610553 19:5240097-5240119 AGCACACATAGGGACAAAGAGGG + Intronic
1164431153 19:28189936-28189958 ATGACACATCTGTCCTAAAATGG - Intergenic
1165959011 19:39519057-39519079 ATCACCCCTCTGGGCACAGAGGG - Exonic
927997484 2:27496107-27496129 ATCACACAGCTGGACAAATTGGG - Intergenic
928602232 2:32914820-32914842 ATCAAAGATCTGGCCACACATGG - Intergenic
935118414 2:100158553-100158575 ATAACACCTCTTGCAAAAGATGG - Intergenic
937438518 2:121898111-121898133 ATCACACAACTGGCCACTGTAGG + Intergenic
937451665 2:122007402-122007424 ATCACACATGTTGCTAAACATGG + Intergenic
938216659 2:129523360-129523382 ATCACACAGGTCGCCAAGGAAGG + Intergenic
938395881 2:130947648-130947670 ATCACATATCTGTCCATAAAAGG + Intronic
939833520 2:147100845-147100867 ATGACACATCTGGCCATGAAAGG - Intergenic
941876499 2:170439034-170439056 ACTACACATATCGCCAAAGAAGG - Intronic
942406914 2:175665898-175665920 ATAACACCTCTGGTCAAATATGG + Intergenic
943515803 2:188885005-188885027 ATCACAAATCATGTCAAAGAGGG - Intergenic
945472639 2:210245324-210245346 AACACACATCTGCCCACAAAAGG + Intergenic
948706848 2:239799907-239799929 TTCATACATTTTGCCAAAGAGGG + Exonic
1169311344 20:4543345-4543367 ATCATACATCTGTTTAAAGAAGG - Intergenic
1169687294 20:8289550-8289572 ATGACACAGCTGGCAAGAGATGG + Intronic
1170359566 20:15530137-15530159 ATTCTACATATGGCCAAAGAAGG - Intronic
1172205863 20:33162451-33162473 ATCACACAGCTGGCCAGTGGCGG + Intronic
1173041013 20:39462562-39462584 AGCAAACATCTGAACAAAGAGGG + Intergenic
1173556555 20:43970189-43970211 ATCACACAGCTGGGGAGAGATGG - Intronic
1173556868 20:43972659-43972681 ATCACACTTCAGGGCAAAGAGGG + Intronic
1174236958 20:49102012-49102034 ATCACACAGCTGGATAAAGCCGG + Intergenic
1174291110 20:49509138-49509160 TTCTCCCATCTGGTCAAAGAGGG + Intronic
1175324597 20:58114294-58114316 ATCACGCATCTAGCCAAACCAGG + Intergenic
1175699283 20:61125413-61125435 ATCTCACACCTGGCCACAGCTGG - Intergenic
1177024768 21:15908250-15908272 ATCACTAATCTTGCCAAATAAGG + Intergenic
1178504800 21:33153746-33153768 ACCACACCTTTGGCCAGAGAAGG + Intergenic
1179878868 21:44285293-44285315 GTCACACAGCTAGCCTAAGATGG + Intergenic
1181011615 22:20044167-20044189 GTCACACATCTGGCCTGAGTGGG - Intronic
1181594984 22:23908294-23908316 ATGACCCATGTGGCCAAAGTGGG - Intergenic
1182012026 22:27009085-27009107 GTCACTCATCTGGCCAGAGTAGG - Intergenic
1182570422 22:31233450-31233472 ATCCCAGAGCTGGACAAAGAAGG - Intronic
1183620081 22:38967086-38967108 ATGAGACAGCTGGCCAAGGATGG + Intronic
1184074247 22:42166015-42166037 ATCACACCTCTGACTAAAGGAGG - Intronic
1184655376 22:45938953-45938975 AACAGACATTTGTCCAAAGAAGG + Intronic
1185417261 22:50717051-50717073 ATCACACAGCTGCCCAAACTCGG + Intergenic
950104850 3:10381668-10381690 ATCCCACATGGGGCCAAAGCTGG - Intronic
950295670 3:11827984-11828006 ATCTCACAACTGGAAAAAGATGG + Intronic
950315976 3:12002716-12002738 ATCATACAGTTGGGCAAAGAGGG - Intergenic
951118512 3:18894653-18894675 CTCACACAGCTTTCCAAAGATGG + Intergenic
952594242 3:34996568-34996590 ATCACACATCTGGTAAATGGTGG - Intergenic
953673608 3:44982886-44982908 ATCACACAGCAGGCAAAAGTAGG - Intronic
953674501 3:44990176-44990198 ATCACAAAGCTGGCCAGAGAAGG - Intronic
955479910 3:59379072-59379094 ATCAAACATCAAACCAAAGATGG + Intergenic
956511908 3:70002191-70002213 TTCACACATCTGTCCAAAGGTGG - Intergenic
956992856 3:74788679-74788701 ACCACACATTTGGCCACAGAAGG - Intergenic
961186521 3:124919787-124919809 ATCACACTCCTGGCTAGAGAAGG - Intronic
961946177 3:130691219-130691241 ATCACACAGCTTGGCACAGAAGG + Intronic
963116707 3:141736506-141736528 ACCACACATCTGCCTAGAGATGG - Intergenic
963413734 3:144966593-144966615 ATAATATATATGGCCAAAGATGG + Intergenic
963436692 3:145277723-145277745 ATCATGCTTCTGGCCAAACAAGG + Intergenic
965830076 3:172776015-172776037 ATAACACATTTTGTCAAAGAAGG - Intronic
966731685 3:183156814-183156836 ATGACACAACTGGTCAAAGTTGG + Intronic
967832540 3:193932760-193932782 GTCACACAGCTGGCAAACGATGG - Intergenic
969497208 4:7533061-7533083 ATCCCACAGCAGCCCAAAGAGGG + Intronic
971051255 4:22865214-22865236 ATCACACACATGGCCAAAGATGG - Intergenic
971380592 4:26093815-26093837 GCCACACATCAGCCCAAAGACGG - Intergenic
975253198 4:72203366-72203388 ATCACACAACAGGCAAAAGCTGG + Intergenic
975439212 4:74391551-74391573 AGTACACCCCTGGCCAAAGAAGG + Intergenic
978311282 4:107387159-107387181 ACCACACATCTGCTCAAGGATGG - Intergenic
979227987 4:118311999-118312021 ATCACAAATCTTTCAAAAGAAGG + Intronic
979738186 4:124115972-124115994 ATCACACATGAGGGGAAAGAGGG - Intergenic
981224013 4:142270262-142270284 ATCGCATATCTTTCCAAAGAGGG + Intronic
981316427 4:143344231-143344253 CTCACACAGCTGGGCTAAGATGG - Intronic
983689171 4:170447053-170447075 ATCACACATTTGACCATAGCAGG + Intergenic
984712045 4:182893865-182893887 ACCACACATTTGGCTAAACATGG + Intronic
985976754 5:3425322-3425344 ATAACATATCTGGTCAACGAGGG + Intergenic
987141328 5:14949565-14949587 ATGACACATCAGTCCAATGAGGG - Intergenic
987466517 5:18278243-18278265 ATCACATATCTGGCCTGGGAGGG + Intergenic
987777949 5:22393880-22393902 ATTCTACATCTCGCCAAAGAGGG - Intronic
988994305 5:36700069-36700091 ATCACATAGCTGTCCAAACATGG - Intergenic
989730199 5:44639877-44639899 ATCACACATCTGGCAAAAGCAGG + Intergenic
993770593 5:91919772-91919794 ATTACACATCTGGACCAAGTTGG - Intergenic
993780245 5:92057280-92057302 ATCAGACACCTCACCAAAGAAGG - Intergenic
995665434 5:114536438-114536460 ATCCCACAGCTGGCCTCAGAGGG - Intergenic
997079418 5:130721149-130721171 ATCCCACATCTAGCCAAGAAAGG - Intergenic
999496730 5:152106515-152106537 ATCACATCTCTGGACAAAGCAGG + Intergenic
1001457852 5:171879745-171879767 AACAGACATCTCACCAAAGAAGG - Intronic
1003019502 6:2497349-2497371 TTCACTCTTCTGGCCAAAAATGG + Intergenic
1004292023 6:14376128-14376150 ATCACACATCTCACCTCAGATGG - Intergenic
1005217453 6:23547856-23547878 TTAACACACCTGGACAAAGAGGG + Intergenic
1005675556 6:28151128-28151150 ATCTCAGATTTGGCCATAGAAGG + Intronic
1006990255 6:38209217-38209239 ATCACCCATCTGGTCCAAGGAGG + Intronic
1013457094 6:110340173-110340195 CTCACACATCTGGCACAAGGAGG + Intronic
1016928619 6:149379920-149379942 TTCAAATATCTGGTCAAAGAAGG - Intronic
1018278196 6:162155827-162155849 AACACAAATTTGGCTAAAGAAGG + Intronic
1018330302 6:162720414-162720436 TACACACATCTGTCCATAGATGG + Intronic
1019221359 6:170475310-170475332 CCCACACATTTGGCCACAGAAGG + Intergenic
1019583025 7:1777873-1777895 AACACACAAATGGCCAACGATGG - Intergenic
1022839678 7:34151157-34151179 ATCACACAACAGGGTAAAGAGGG + Intronic
1023799331 7:43819831-43819853 AGCACACACCTGGCCAAGGGAGG - Intergenic
1028354648 7:89891415-89891437 ATCACATATTTGGCAAAATAGGG + Intergenic
1028619059 7:92803667-92803689 ATCACACATGTGCCCCAAAATGG - Intronic
1028725820 7:94086532-94086554 ATCCCACAGCTGGCTTAAGATGG - Intergenic
1031841856 7:126751815-126751837 ATCACTCTTCTGGCCTGAGAAGG - Intronic
1032806248 7:135357596-135357618 AGCACAGATCTGGGCTAAGATGG + Intergenic
1034048740 7:147959312-147959334 AACCCACATCTGTCCTAAGAAGG - Intronic
1034154775 7:148947689-148947711 TTCCTAGATCTGGCCAAAGATGG - Intergenic
1034212351 7:149374894-149374916 ATGCCACCCCTGGCCAAAGACGG + Intergenic
1035247023 7:157569234-157569256 ACCACATCTTTGGCCAAAGAGGG - Intronic
1036525669 8:9532307-9532329 AACACACATCTCACCAAAGCTGG - Intergenic
1038044128 8:23751758-23751780 ATCACACATATGTGGAAAGATGG + Intergenic
1039848333 8:41342008-41342030 ATCACGCATGAGGCTAAAGACGG + Intergenic
1041433915 8:57817215-57817237 ATCACACATCTGGCTCCAGCTGG - Intergenic
1042183952 8:66118734-66118756 ATAACCCATCTGACCACAGAAGG - Intergenic
1042351972 8:67786383-67786405 AACCCACATCTGGCCAAGCATGG + Intergenic
1043891885 8:85658125-85658147 ATCTCTCATCTGTCCAAACAAGG - Intergenic
1043894219 8:85724572-85724594 ATCTCTCATCTGTCCAAACAAGG + Intergenic
1043894575 8:85727657-85727679 ATCTCTCATCTGTCCAAACAAGG + Intergenic
1043894931 8:85730742-85730764 ATCTCTCATCTGTCCAAACAAGG + Intergenic
1043895287 8:85733827-85733849 ATCTCTCATCTGTCCAAACAAGG + Intergenic
1043897389 8:85747981-85748003 ATCTCTCATCTGTCCAAACAAGG - Intergenic
1043897745 8:85751069-85751091 ATCTCTCATCTGTCCAAACAAGG - Intergenic
1043898101 8:85754154-85754176 ATCTCTCATCTGTCCAAACAAGG - Intergenic
1043899715 8:85766349-85766371 ATCTCTCATCTGTCCAAACAAGG - Intergenic
1043901322 8:85778542-85778564 ATCTCTCATCTGTCCAAACAAGG - Intergenic
1043901677 8:85781627-85781649 ATCTCTCATCTGTCCAAACAAGG - Intergenic
1043903287 8:85793817-85793839 ATCTCTCATCTGTCCAAACAAGG - Intergenic
1043904898 8:85806010-85806032 ATCTCTCATCTGTCCAAACAAGG - Intergenic
1043906509 8:85818201-85818223 ATCTCTCATCTGTCCAAACAAGG - Intergenic
1045584143 8:103512297-103512319 ATCACAAAGCAGGTCAAAGAAGG + Intronic
1046264719 8:111815539-111815561 CTCACACATTTGCTCAAAGAAGG + Intergenic
1046709949 8:117499526-117499548 ATCACACTGCTGTCCAAAAATGG + Intergenic
1046879317 8:119290835-119290857 ATCACAAAACTGGGCAGAGAAGG - Intergenic
1048216714 8:132502269-132502291 ATCACATAGCTGGACAATGAGGG + Intergenic
1048277742 8:133079935-133079957 AGCACTCATCTAGCCATAGAGGG - Intronic
1048469334 8:134693330-134693352 TTAACACAACTGGCCAAATATGG + Intronic
1050493945 9:6219570-6219592 ATTACACAGCTGGTCAATGATGG - Intronic
1050635153 9:7604624-7604646 ATCACATCTCTGGCCATAGCAGG - Intergenic
1053946611 9:43315586-43315608 ATCACACATAGGAACAAAGAAGG + Intergenic
1056549771 9:87642594-87642616 ATCACACTTCAGGGCTAAGAAGG + Intronic
1056575657 9:87854356-87854378 ATCAGACTTCAGGCCAAAGCTGG - Intergenic
1056933680 9:90899162-90899184 ATCCCCCATCAGGCCAAAGCAGG + Intergenic
1058936945 9:109778641-109778663 ATTACTCCTCTGACCAAAGATGG - Intronic
1059337587 9:113578950-113578972 ATCACACAGCTAGCAAATGATGG + Intronic
1059529127 9:115019494-115019516 AGCACACATTTCCCCAAAGAAGG + Intergenic
1060169525 9:121450031-121450053 ATCACACTACTGGCCAATCATGG + Intergenic
1060374116 9:123103264-123103286 ATCACACATCTGGCCAAAGAAGG - Exonic
1062637618 9:137499888-137499910 AGCAGACATCTGGCCTATGAGGG + Intronic
1203589741 Un_KI270747v1:44144-44166 ATCACACATAGGAACAAAGAAGG + Intergenic
1187018031 X:15350080-15350102 ACCACACAACTGGCTAAAGCAGG - Intronic
1191889702 X:65927410-65927432 AGCACACATCTGGACAAGGGAGG + Intergenic
1193136218 X:77973586-77973608 AACACACATTTCACCAAAGAAGG - Intronic
1195887860 X:109659078-109659100 ATAACAGATCTACCCAAAGATGG + Intronic
1196294121 X:113979331-113979353 ACCCCACCTCTGGCCAAAAATGG - Intergenic
1197412028 X:126128635-126128657 ATAACACATATGCCCAATGATGG - Intergenic
1198687640 X:139244520-139244542 ATCACACATCTTGCCATATAAGG - Intergenic
1201494562 Y:14578997-14579019 ATCACACATCTTTCCAAGAAGGG - Intronic