ID: 1060375001

View in Genome Browser
Species Human (GRCh38)
Location 9:123109623-123109645
Sequence GTGCGAAGGAGCCACAGTGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 138
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 127}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060374996_1060375001 19 Left 1060374996 9:123109581-123109603 CCAGACAAGAGGGTCAGTCTATG 0: 1
1: 0
2: 0
3: 16
4: 149
Right 1060375001 9:123109623-123109645 GTGCGAAGGAGCCACAGTGCGGG 0: 1
1: 0
2: 1
3: 9
4: 127

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060375001 Original CRISPR GTGCGAAGGAGCCACAGTGC GGG Intronic
901167094 1:7228937-7228959 ATGGGAAGGGGCCACAGAGCAGG + Intronic
903359304 1:22766863-22766885 GTGAGAAGGAACCCCAGTGTGGG + Intronic
907395597 1:54187552-54187574 GTGGGAAGGAAACTCAGTGCTGG - Intronic
908049711 1:60215812-60215834 CTGGGAAGGAGCCACATTTCTGG - Intergenic
908561634 1:65311733-65311755 GTGTGAAGGAGCCTCACTTCAGG + Intronic
912586825 1:110774544-110774566 GTGGGAAGGACTCTCAGTGCTGG - Intergenic
912965796 1:114236179-114236201 GAGGGCAAGAGCCACAGTGCTGG - Intergenic
919943036 1:202301437-202301459 CTGGGAAGAAGCCACAGTTCAGG - Intronic
920398550 1:205663142-205663164 CTGCGTAGCAGCCACACTGCTGG - Exonic
922061867 1:222100592-222100614 GTGAGATGGAGCAACAATGCAGG - Intergenic
923094148 1:230761378-230761400 GTGGGGAGGAGCCTCAGGGCTGG - Intronic
1066135084 10:32437873-32437895 GTGAGAAGGAGTCACAGTCTTGG - Intergenic
1068089916 10:52420943-52420965 CTGCGTGGGAGCCACAGGGCCGG - Intergenic
1070617922 10:77983220-77983242 CTGCAAAGGAGCCACAAGGCAGG + Intronic
1072703521 10:97662652-97662674 GGGAAAAGAAGCCACAGTGCTGG + Intronic
1076529634 10:131135894-131135916 GGGCGGAGGAGCCACAGCCCGGG + Intronic
1079081378 11:17415646-17415668 GTCTGGAGGAGCCACATTGCGGG - Intronic
1079560063 11:21811091-21811113 GTGGGCAGGAGGCACAGAGCCGG + Intergenic
1081601288 11:44496646-44496668 GTGTGAAAGAGCCACAGGGAGGG - Intergenic
1083148018 11:60773063-60773085 GGGAGAGGGAGCCACAGTACGGG + Intronic
1083547979 11:63563143-63563165 GTGGGAAGGAACCACGGTGCTGG - Intronic
1085527310 11:77171967-77171989 CTGCGTCGGAGCCACAGTGCGGG + Intronic
1088554646 11:111049320-111049342 GTCAGAATGAGCCACAGGGCAGG + Intergenic
1089201225 11:116725796-116725818 GGGCGATGGAGCCACTCTGCAGG - Intergenic
1089338015 11:117738757-117738779 GTGGTCTGGAGCCACAGTGCAGG + Intronic
1089358092 11:117868876-117868898 GTGAGCAGGAGCCGGAGTGCTGG - Intronic
1090442316 11:126734760-126734782 GTGCTAAGGAATCACAGTGGTGG + Intronic
1090734263 11:129597654-129597676 CTGCTAAGGAGCAACAGTGGAGG + Intergenic
1091298809 11:134491953-134491975 ATCAGAAGGAGCCACAGTTCAGG - Intergenic
1097290880 12:57913942-57913964 ATGTGAAGGAGCCAGGGTGCTGG - Intergenic
1098202800 12:68074737-68074759 GTGGGAAGGAGCCAAGGGGCAGG + Intergenic
1098344902 12:69491776-69491798 GTGTGAGTGAGCCACAGTGCTGG + Intronic
1102535184 12:113575901-113575923 GAGAGGAGGAGCCACAGTACAGG + Intergenic
1102827412 12:115961127-115961149 CTGAGAAGGAATCACAGTGCAGG + Exonic
1102907494 12:116688039-116688061 GTGCCCAGGAGACTCAGTGCAGG + Intergenic
1103075759 12:117981267-117981289 GTGGGAGGGAGCCAAAGTGAGGG - Intergenic
1105728430 13:23187649-23187671 GTGCGAGGGACCCAGAGTCCCGG - Intronic
1107130357 13:36887931-36887953 GTAGGAAGTAGCCACAGTGTGGG + Intronic
1107481964 13:40792645-40792667 GGCTGAAGGAGCCACACTGCAGG + Intronic
1107692864 13:42969356-42969378 GTGAGAATGTGCCACAGGGCCGG - Intronic
1113629907 13:111875091-111875113 GGGTGACGGAGCCAGAGTGCGGG + Intergenic
1117097034 14:52309563-52309585 GGGCAAAGGAGAGACAGTGCTGG - Intergenic
1121016557 14:90552656-90552678 GTCCCCAGGAGCCACACTGCAGG - Intronic
1121092805 14:91194518-91194540 TGGGGAAGGAGCCACAGTGAGGG + Intronic
1122417277 14:101556445-101556467 GGACGAAGGTGCCCCAGTGCTGG - Intergenic
1122952144 14:105050928-105050950 GTGCACAGGAACCACATTGCTGG + Exonic
1125857137 15:42961389-42961411 ATGCAAATGAGCCACTGTGCTGG + Intronic
1127932449 15:63605874-63605896 CTGCATAGGAGCCCCAGTGCCGG + Intergenic
1132522339 16:397499-397521 GCGAGAAGGAGCCGCAGAGCCGG - Intronic
1135408244 16:22213771-22213793 GTGTGAAGTTGCCACACTGCTGG - Intronic
1139059502 16:63231664-63231686 ATGAGAAGCAGCCACAGTACTGG - Intergenic
1140029782 16:71326392-71326414 GTGCTCAGGAGGCACAGTGCTGG + Intergenic
1141842665 16:86584102-86584124 GTGGAAAGGAGCCACAGTGCTGG + Intergenic
1141933898 16:87223513-87223535 GTGTGAAAGATACACAGTGCAGG - Intronic
1144672449 17:17140609-17140631 GTGCCCAGGAGCCAGACTGCTGG + Intronic
1148227198 17:45907181-45907203 CTATGAAGGAGCCACAGGGCAGG - Intronic
1149584527 17:57776650-57776672 GTGGGAAGGAGGGAGAGTGCAGG + Intergenic
1150617654 17:66784718-66784740 CTGTGACGGAGCTACAGTGCAGG - Intronic
1152698375 17:81807206-81807228 GGGCGAAGGACCCACAGAGTAGG - Intronic
1154390964 18:13935725-13935747 GTGCAGAGAAGCCACAGTACAGG - Intergenic
1155058473 18:22206317-22206339 GTGCTCTGGAGCCACACTGCAGG - Intergenic
1157282220 18:46353685-46353707 GTGGGAAGGAGCCAGAGTCCTGG - Intronic
1160838520 19:1136071-1136093 ATTCGAAGGAGACACAGTCCCGG + Intronic
1162418591 19:10552990-10553012 GTGCGAGGGAGCCGGAGTGTGGG - Exonic
1165741971 19:38210121-38210143 GTGAGAGGGAGCCACATTGCGGG - Intergenic
1165827257 19:38712507-38712529 CTGCCAGGGAGCCACAGTGGTGG + Intronic
925246730 2:2390168-2390190 CTGCACAGGAGACACAGTGCTGG + Intergenic
927062402 2:19436197-19436219 GTAAGGAGGAGCCACAGAGCAGG - Intergenic
927926991 2:27020540-27020562 GTGGGAAGGAGGCTCACTGCTGG + Intronic
928422597 2:31150510-31150532 GTGCAAAAGAAGCACAGTGCTGG + Intronic
940404900 2:153289747-153289769 GTGGGAAGGAGCTAAACTGCAGG + Intergenic
940954525 2:159712812-159712834 GGGCCAAGGGGCCACAGCGCAGG + Intronic
943936056 2:193918679-193918701 GTCCCAAGGAGGCACAGAGCAGG - Intergenic
1174579731 20:51563025-51563047 GGCCGAAGGAGCCACGGAGCTGG - Intergenic
1175108633 20:56630841-56630863 GGGCGAAGGAGCCAGAGCCCGGG - Intronic
1179038216 21:37778645-37778667 GTGGGAAGGGGCCAGAGTCCAGG - Intronic
1180967819 22:19799694-19799716 CAGCCAAGGAGTCACAGTGCAGG + Intronic
1181133340 22:20747524-20747546 GACCATAGGAGCCACAGTGCAGG - Intronic
1184889924 22:47373409-47373431 GTGCTAATGAGCCCCAGTTCTGG + Intergenic
1185398120 22:50602910-50602932 CTGCGAAGGGAACACAGTGCTGG + Intronic
949111238 3:263144-263166 CTGCGATGGAGCTTCAGTGCTGG - Intronic
950520720 3:13496259-13496281 GTGCGAGGGAGCCAGAGGCCAGG + Intronic
953386085 3:42506326-42506348 GGCCAAAGGAGCCACAGTGAAGG - Intronic
953783754 3:45895018-45895040 GTGGGAAGGATCCACTGTGGGGG + Intronic
954797417 3:53168655-53168677 ATGGGAAGGAGCCACTGTGTGGG + Intronic
961213666 3:125143737-125143759 GTGGGAAGGACCCCCAGGGCTGG + Intronic
963953189 3:151225120-151225142 GCCCTAAGGAGTCACAGTGCTGG - Intronic
968883135 4:3311499-3311521 GAGTGAAGGAGTGACAGTGCGGG + Intronic
969676400 4:8616672-8616694 GTGAGGAGGAGCCACAGGGTGGG + Intronic
970650516 4:18172331-18172353 GTGAAATAGAGCCACAGTGCTGG + Intergenic
972511296 4:39770663-39770685 CTGCGGTGGGGCCACAGTGCTGG + Intronic
974754811 4:66189391-66189413 GTGAGAAGGAGACACAGTTGGGG - Intergenic
979498375 4:121410981-121411003 GTGCGAACGACACCCAGTGCCGG - Intergenic
984240102 4:177208137-177208159 GTGGGAATGAGCCGCAGTGTTGG + Intergenic
988698261 5:33646032-33646054 GTTCCAAGGAACCACTGTGCAGG + Intronic
993968496 5:94387830-94387852 GTGGGGAGGAGCCACATTTCTGG + Intronic
995556622 5:113336412-113336434 GTGTGCAGGAGACACACTGCAGG + Intronic
997648354 5:135496749-135496771 GTCAGCAGGAGCCTCAGTGCGGG - Intergenic
998051650 5:139041057-139041079 GTGGGAAGGAGCCAAAGCCCTGG + Intronic
1001583839 5:172819502-172819524 ATGCGATGAAGCCACAGAGCAGG + Intergenic
1002067426 5:176658949-176658971 GGGCCAAGGAGCCACATTGCTGG - Exonic
1003631279 6:7790018-7790040 CTGAGAAGGAGCAACAGAGCAGG - Intronic
1007686406 6:43669753-43669775 GAGGGAGGGAGCCACAGTGTGGG - Intronic
1008131214 6:47721568-47721590 GAGCTATGGAGCCACAGAGCAGG - Exonic
1012131329 6:95497227-95497249 ATGCGCAGGAGCCCCACTGCGGG - Intergenic
1012946299 6:105469490-105469512 GTCCTAAAGAGGCACAGTGCTGG + Intergenic
1013289474 6:108708167-108708189 CTGCCAAAAAGCCACAGTGCTGG - Intergenic
1013584801 6:111568839-111568861 GTGGGAAGGATTCACAGAGCAGG - Intronic
1017816040 6:158017351-158017373 GTCGGAAGGGGCCTCAGTGCAGG + Intronic
1017841157 6:158224101-158224123 GTGGGAAGGAGCCAGAATGGAGG - Intergenic
1019274744 7:170058-170080 GTGGGCAGGAGCCACCGGGCTGG - Intergenic
1019388023 7:769438-769460 GGGCGTAGGATGCACAGTGCAGG + Intronic
1019621251 7:1993270-1993292 GTGGGCAGGACCCACAGTGCAGG + Intronic
1019998681 7:4742087-4742109 CTGCGGAGGAGCCACAGCTCCGG - Intronic
1020210850 7:6157215-6157237 GTGCAACGGAACCACACTGCAGG - Intronic
1020732670 7:11903262-11903284 GTGCCAAGGATCCACATTGAGGG + Intergenic
1024723434 7:52165132-52165154 GTGGTAAGTAGCAACAGTGCTGG - Intergenic
1027167770 7:75847764-75847786 GTGCCAAGGAGCCACACTGGCGG + Intronic
1027552007 7:79610492-79610514 GTTCCTAGGAGACACAGTGCAGG + Intergenic
1030987545 7:116260275-116260297 ATGCAAAGGACCCACTGTGCTGG + Intergenic
1034055663 7:148032441-148032463 GACCGAAGGAGCTACCGTGCTGG + Intronic
1037929146 8:22867273-22867295 GTCAGAAGGTGCCAAAGTGCTGG + Intronic
1038310257 8:26440970-26440992 GTGCGAAGGAGGAGCTGTGCCGG - Intronic
1039180993 8:34865931-34865953 GTCAGATGGAGCAACAGTGCTGG + Intergenic
1041037884 8:53813875-53813897 GTGAGAACGAGCCACCGTGTGGG + Intronic
1045968214 8:108050730-108050752 GTGAGAGGGAGCCAGAGTTCAGG - Intronic
1049290194 8:141797677-141797699 GTGGGAGGGAGCTAGAGTGCGGG + Intergenic
1049411354 8:142475353-142475375 GTGGGGAGGGGCCGCAGTGCCGG - Intronic
1053014746 9:34655369-34655391 ATGGGAAGGGGCCACAGTGAGGG - Intronic
1057140787 9:92725727-92725749 GTTTCAAGGAGCCACTGTGCAGG + Intronic
1059989040 9:119847330-119847352 GAGTGAGGGAGCCACAGAGCTGG - Intergenic
1060374432 9:123105920-123105942 GTGCTCTGGAGCCACAGTCCTGG - Intergenic
1060375001 9:123109623-123109645 GTGCGAAGGAGCCACAGTGCGGG + Intronic
1187291909 X:17962676-17962698 GTATGAAGGAGCCAGAATGCTGG - Intergenic
1190002683 X:46704785-46704807 GTGCTAAGGAGACACAGGCCTGG + Intronic
1195698189 X:107682413-107682435 GTGATAAGGAGCCACAGAGAGGG - Intergenic
1200072813 X:153537401-153537423 GTGCCAAGGAGCCTCACGGCTGG - Intronic
1201516883 Y:14827502-14827524 ATAGGCAGGAGCCACAGTGCCGG - Intronic