ID: 1060376395

View in Genome Browser
Species Human (GRCh38)
Location 9:123118381-123118403
Sequence TGTCCAGTGCTGAAACTGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060376393_1060376395 -4 Left 1060376393 9:123118362-123118384 CCTGCATGCAGACACCTTTTGTC 0: 1
1: 0
2: 0
3: 11
4: 173
Right 1060376395 9:123118381-123118403 TGTCCAGTGCTGAAACTGCCTGG No data
1060376392_1060376395 24 Left 1060376392 9:123118334-123118356 CCTCATTACTTGGGGCATTTAGC 0: 1
1: 0
2: 1
3: 7
4: 97
Right 1060376395 9:123118381-123118403 TGTCCAGTGCTGAAACTGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060376395 Original CRISPR TGTCCAGTGCTGAAACTGCC TGG Intronic
No off target data available for this crispr