ID: 1060384901

View in Genome Browser
Species Human (GRCh38)
Location 9:123216162-123216184
Sequence CAGGCAAAGGATTAGGAAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 423
Summary {0: 1, 1: 0, 2: 3, 3: 34, 4: 385}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060384901 Original CRISPR CAGGCAAAGGATTAGGAAGG GGG (reversed) Intronic
900009011 1:89002-89024 CAGGCAGAGGAGTAGCAATGTGG - Intergenic
901274581 1:7981216-7981238 CAGGCAACGGATGAGGAAACAGG - Intronic
903571297 1:24307588-24307610 CAGGAAAAGGAGAAGGAAGTGGG + Intergenic
903573540 1:24323424-24323446 CAGGCAGAGGACTGGGAAGCAGG + Intronic
904422358 1:30402456-30402478 CAGCCCATGGATTTGGAAGGAGG + Intergenic
904441022 1:30530877-30530899 CAGGAAAAGGATGGGCAAGGGGG - Intergenic
904810033 1:33157484-33157506 CTGACAAAGAATAAGGAAGGGGG - Intronic
904839436 1:33362631-33362653 GAGGCAAGGGAAAAGGAAGGAGG + Intronic
904967807 1:34392258-34392280 TAGGCAAAGGACCAGGAAAGAGG - Intergenic
906306851 1:44724997-44725019 CAGGAAAGGGAACAGGAAGGTGG - Intronic
906870267 1:49471684-49471706 TAGACAAAGGATCAGGAAAGAGG + Intronic
907240713 1:53079464-53079486 CAGGCACAGGAGTAGGTATGTGG + Intronic
907297266 1:53463273-53463295 CAGGGACAGGAACAGGAAGGAGG - Intronic
907564850 1:55425250-55425272 CAGGCCCAGGATTAGGAACTGGG + Intergenic
908289834 1:62654093-62654115 CAGCCAAAGGATGAGTAATGAGG + Exonic
909364503 1:74803488-74803510 AAGGTAAAGGATTATTAAGGTGG - Intergenic
909602373 1:77473949-77473971 CTGGCAAAGGCTCAGGGAGGAGG + Intronic
909628663 1:77748026-77748048 CATGAAAAGGATTAGTGAGGAGG - Intronic
910108955 1:83661513-83661535 CAGGCAAAGAATAAAGGAGGAGG - Intergenic
910128516 1:83873823-83873845 CAGGAAGAGGAAAAGGAAGGTGG - Intronic
910160116 1:84263407-84263429 CAGGCAAGGGATATGGAAGAAGG + Intergenic
910444977 1:87290969-87290991 GAGGCAGAGAGTTAGGAAGGAGG + Intergenic
911210006 1:95129053-95129075 CAGACATTAGATTAGGAAGGAGG - Intronic
911501916 1:98697201-98697223 CAGGCCTAGGATCAGGAAGGTGG + Intronic
912283850 1:108347211-108347233 CAGGAAAAGGGAGAGGAAGGGGG - Intergenic
912371963 1:109180576-109180598 CAGGTAAAGGATTTAGAAAGGGG + Intronic
912726116 1:112060136-112060158 GGGGGAAGGGATTAGGAAGGAGG + Intergenic
912823820 1:112887711-112887733 CAGCCAAAGCAGCAGGAAGGCGG - Intergenic
913131439 1:115841150-115841172 GAGATAAAGGCTTAGGAAGGGGG + Exonic
914087398 1:144465405-144465427 TAGGCAAAGGATCAGCAAAGGGG + Intergenic
914193178 1:145428376-145428398 TAGGCAAAGGATCAGCAAAGAGG + Intergenic
914265088 1:146031730-146031752 TAGCCAAAGGATCAGGAATGAGG - Intergenic
914311213 1:146468798-146468820 TAGGCAAAGGATCAGCAAAGGGG - Intergenic
914408399 1:147400622-147400644 CAGCCACAGGATCAGAAAGGTGG - Intergenic
915254376 1:154614804-154614826 GAGGCAAAGGGGTAGGATGGAGG + Intronic
915465614 1:156096208-156096230 CAGGCAGAGGAAACGGAAGGGGG - Intronic
915618984 1:157067324-157067346 CAGGCCAAGGCACAGGAAGGGGG - Intergenic
916915240 1:169399844-169399866 CAGACAACGGTATAGGAAGGAGG + Intronic
918085827 1:181244519-181244541 TAGTCAAGGAATTAGGAAGGCGG - Intergenic
918142527 1:181731611-181731633 CAGGCACAGGCTCAGGGAGGAGG + Intronic
918148877 1:181781348-181781370 CAGGGAAAGGAGAAGGAAGTGGG - Intronic
918593678 1:186268654-186268676 TAGCCAAAGGATTAGGAAAGGGG + Intergenic
919076961 1:192825431-192825453 CAGCCAAAGAACTAGGAAAGGGG - Intergenic
920565133 1:206967059-206967081 CAGGCACAGTATGAGGAAGAGGG + Exonic
920844332 1:209581118-209581140 CAGGCACAGGAGGAGGATGGAGG + Intergenic
922550826 1:226493137-226493159 CAGCTACAGGATTAGAAAGGAGG - Intergenic
922632018 1:227125120-227125142 TAGCCAAAGGATTAGGAAAGGGG + Intronic
922858804 1:228797897-228797919 CAGGCCAAGGAGGAGCAAGGTGG + Intergenic
1063744324 10:8862631-8862653 GAAGCAAAGGAAGAGGAAGGGGG - Intergenic
1064156358 10:12906364-12906386 GAGGCAAATGAAGAGGAAGGCGG + Intronic
1064275724 10:13903243-13903265 TAGGAAAGGGATTAGGAACGGGG - Intronic
1065121189 10:22531819-22531841 CAGGGAAAGAATTAGGAAAATGG + Intergenic
1065610385 10:27466368-27466390 CAGGCAAAGGGAGAAGAAGGAGG - Intergenic
1067523274 10:47023523-47023545 CAGGCAAGGGAGCAGGCAGGAGG + Intergenic
1068806203 10:61196425-61196447 CAGGGAAAGCTTTAAGAAGGAGG - Intergenic
1069567271 10:69472186-69472208 CAGGCAGAGGATGAGGGAAGGGG - Intronic
1070315722 10:75310429-75310451 CAGTCAAAGGATCAGGAAAAGGG + Intergenic
1070739685 10:78894548-78894570 CAGGCAGAGGATGTGGAAGGGGG + Intergenic
1070954119 10:80453784-80453806 CGGGCGAAGGATTAGGAAAATGG - Intergenic
1071324291 10:84496687-84496709 TAGCCAAAGGATCAGGAAAGAGG - Intronic
1072744994 10:97933586-97933608 CAGGCAGAGGATTGGGAGAGGGG + Intronic
1073528385 10:104207544-104207566 CAGCCAGAGGATTAAGAAGAAGG + Intronic
1073931032 10:108577243-108577265 CTGGCAGAGGTGTAGGAAGGAGG - Intergenic
1073935996 10:108632544-108632566 GAGGCAAAGGGCTGGGAAGGAGG + Intergenic
1074276182 10:112004690-112004712 CAGGCATAGGATCAGGAAACAGG + Intergenic
1074373579 10:112920604-112920626 CAGGCCACTGATTAGGCAGGTGG + Intergenic
1074399814 10:113132856-113132878 CTGGCAGAGGATTAGGACAGAGG + Intronic
1074428196 10:113370630-113370652 CAGCCAGAGGATTAGGAAGTAGG - Intergenic
1075390759 10:122089601-122089623 CAGCCAAAGGCCTAGGGAGGCGG - Intronic
1076372971 10:129966906-129966928 CAGGCCAGGGATGGGGAAGGGGG + Intergenic
1077059418 11:611271-611293 CTGGCAGATGCTTAGGAAGGAGG + Intronic
1079454260 11:20623473-20623495 CAGGCAAAGGACAAAGAATGGGG - Intronic
1081257018 11:40910316-40910338 AAAGGAAAGGATTAGGAAGTAGG + Intronic
1081523109 11:43902096-43902118 GAGGCTAAGGAAGAGGAAGGAGG + Intronic
1083511138 11:63210381-63210403 GAGGCAGAGGCTGAGGAAGGGGG + Intronic
1086898026 11:92335981-92336003 CAGGCAAGGGGTGGGGAAGGTGG + Intergenic
1086924200 11:92622695-92622717 CAGCTAAAAGATTAGGAAAGAGG + Intronic
1088746189 11:112806894-112806916 CAGGGAAAGGGTTAGGCAGCTGG + Intergenic
1089023424 11:115242067-115242089 CTGGCAGAGGATTAGAAAAGAGG + Intronic
1089678678 11:120107499-120107521 GAGGCAAAGGAGTGGGGAGGGGG - Intergenic
1090716814 11:129438442-129438464 CAGGCAAAAGAAGAGGAAGAAGG - Intronic
1090825578 11:130383159-130383181 CTGGGAAAGCATTAGGAAAGAGG + Intergenic
1091020466 11:132095234-132095256 TAGGCAAAGAATCAGAAAGGCGG - Intronic
1091833169 12:3564788-3564810 CATGCAAAGGATTTTCAAGGGGG - Intronic
1092490943 12:8944474-8944496 CAGTCACAGGATTAGGAAACAGG + Intronic
1092629136 12:10359865-10359887 AAAGCCAGGGATTAGGAAGGTGG + Intergenic
1092789579 12:12059690-12059712 CAGGCTAAGGAAGAAGAAGGAGG - Intronic
1093125252 12:15321712-15321734 CAGGCAGAGGAGGAGGAAGAGGG + Intronic
1093541152 12:20286957-20286979 AAGGCAAAGGATAAGCATGGTGG + Intergenic
1094533544 12:31300349-31300371 CAGGCAAAAGAGTGGGATGGGGG + Intronic
1096148471 12:49294798-49294820 CTGGCACAGGAGTAGGGAGGAGG - Exonic
1096530471 12:52239524-52239546 CAGGCTAAGGATTCGGGAGGAGG + Intronic
1096582181 12:52592731-52592753 CAGGCAAGGGACTTGGAGGGAGG + Intronic
1096910034 12:54974189-54974211 CAGGCATAAGATTAGGAAAAAGG - Intronic
1097067733 12:56333322-56333344 CAGCCAAAGGATGAAGCAGGCGG + Intronic
1097971688 12:65639695-65639717 TAGGGATAGGATTAGGATGGGGG - Intergenic
1098241488 12:68471933-68471955 CAGGAAAAGTCTTAGGAAGAAGG + Intergenic
1099055311 12:77833111-77833133 CAGAAAAAGAATTGGGAAGGAGG - Intronic
1099211377 12:79793209-79793231 CAGCCAAACAATCAGGAAGGGGG + Intronic
1099435700 12:82642640-82642662 GAGGCAGAGCATTAGGTAGGGGG + Intergenic
1101964804 12:109275103-109275125 CAGGGAAAGGAATAAGAAGATGG - Intergenic
1102615927 12:114154128-114154150 AAGGCAATGGATTTGGTAGGTGG - Intergenic
1103005088 12:117414632-117414654 CAGGAAGAGGAGGAGGAAGGAGG - Intronic
1104374175 12:128249489-128249511 CATGCAAAGGAAGAGGAAGTGGG - Intergenic
1104588509 12:130066267-130066289 CAGGGACAGGATAAGGATGGGGG + Intergenic
1106023843 13:25939409-25939431 CAGGCACAGGACCAGGACGGAGG + Intronic
1106030577 13:25998510-25998532 CAGACAAAGGAACAGGAAAGGGG - Intronic
1106402676 13:29444890-29444912 CAGGCAAAGGCAAAGGAAGGAGG - Intronic
1108582775 13:51840866-51840888 GAGTCAAAGGATGTGGAAGGAGG - Intergenic
1108596448 13:51954144-51954166 CAGGCAAAGGTTAAGGAAGAAGG + Intronic
1111425984 13:88082965-88082987 GTGGCAAAGGATTTTGAAGGTGG - Intergenic
1111692412 13:91580711-91580733 CATGGCAAGGAATAGGAAGGTGG - Intronic
1111793453 13:92887867-92887889 CAGGCAAAGACTCAGGATGGTGG + Intergenic
1111880584 13:93951386-93951408 CTGGCATAGGATGAGGAAGATGG - Intronic
1112963123 13:105152764-105152786 CAGTCGAGGGATTAGGAAGTGGG - Intergenic
1112983560 13:105418122-105418144 TATACAAAGGATGAGGAAGGTGG - Intergenic
1113033357 13:106018953-106018975 CCGGGAAATGAGTAGGAAGGAGG + Intergenic
1113284059 13:108827210-108827232 AATGCAAAGGAATAGGAAGCTGG - Intronic
1113943700 13:114032469-114032491 CAGGCAAGGGTTTCAGAAGGTGG - Intronic
1114376328 14:22150396-22150418 CAGGCATGGGATAAGGAAAGGGG - Intergenic
1114753969 14:25237667-25237689 CAGGAAAAGAATGAGGAAGCAGG - Intergenic
1115365132 14:32549378-32549400 CAGATAAAGGAAAAGGAAGGTGG + Intronic
1115731698 14:36276236-36276258 CAGGAAAAGGACTAGGACGTGGG - Intergenic
1115746588 14:36443962-36443984 CGGGCTCAGGCTTAGGAAGGAGG - Intergenic
1115855619 14:37626772-37626794 TAGCCAAAGGATCAGGAAAGGGG + Intronic
1118342989 14:64911623-64911645 CAGGGGGAGGATTAGGAAAGAGG - Intergenic
1119160563 14:72449018-72449040 CAGGCCAATGCTTATGAAGGCGG - Intronic
1121415197 14:93774542-93774564 CAGCCCAAGGATCAGGCAGGAGG - Intronic
1121523766 14:94604196-94604218 CAGGAAGGGGAGTAGGAAGGAGG - Intronic
1123193937 14:106598606-106598628 GAGGGGAAGGACTAGGAAGGAGG - Intergenic
1124220537 15:27846758-27846780 CAGGGAAAGGAATGGGGAGGAGG + Intronic
1126274109 15:46856082-46856104 CAGGCAAGCAATTATGAAGGTGG - Intergenic
1126700869 15:51366435-51366457 AAGGGAAAGGTTTAGGAAGGTGG + Intronic
1127156268 15:56128639-56128661 CAGGCAACAGACAAGGAAGGGGG + Intronic
1127242657 15:57134917-57134939 CAGGAAAAGGAGGAGGAATGTGG - Intronic
1127975050 15:63990934-63990956 CAGGCAGAGGAGTAGGGAGGGGG - Intronic
1128156286 15:65393945-65393967 CAGGGGAAGGGTGAGGAAGGAGG - Intronic
1128913482 15:71538328-71538350 AAGGCAAAGGGTTGGGAATGTGG - Intronic
1129674138 15:77623225-77623247 CAGGCCAAGGAAGAGGCAGGGGG + Intronic
1129771560 15:78206365-78206387 CAGGGACAGGCTGAGGAAGGAGG - Intronic
1130109758 15:80954474-80954496 CAGGGAAAGGAGTAGGATGTGGG + Intronic
1130311831 15:82763039-82763061 CAAGCAAAGCTTTGGGAAGGAGG + Intronic
1131656561 15:94466545-94466567 CAGGATAAGAATAAGGAAGGAGG - Intronic
1132077234 15:98831973-98831995 GAGACAAAGGATGAGGAAGGGGG + Intronic
1132422229 15:101680325-101680347 TAGCCAAAGGACTAGGAAAGGGG - Intronic
1132998738 16:2838565-2838587 AAGGCAGAGGAGTTGGAAGGAGG + Intronic
1133362331 16:5184376-5184398 CAGGTAAAGGCTTGGGAAGTGGG + Intergenic
1134386378 16:13777327-13777349 CAGGCATAGGCTTGGGAAGCAGG - Intergenic
1135876969 16:26211195-26211217 TAGCAAAAGGAATAGGAAGGAGG - Intergenic
1136548368 16:30967913-30967935 CAGGCAAACTAGGAGGAAGGTGG - Intronic
1136677415 16:31923929-31923951 CAGCCAGAAGATAAGGAAGGGGG + Intergenic
1137386702 16:48048753-48048775 CAGCCAAGGAATTAGGAAGGGGG + Intergenic
1139310154 16:66021311-66021333 CAGGGAAGGTATTGGGAAGGTGG - Intergenic
1139762889 16:69201440-69201462 AATGGAAAGGATTAGGGAGGCGG + Intronic
1140297531 16:73724080-73724102 CAGACAAAAGAATAGGAAGGAGG - Intergenic
1142455324 16:90217962-90217984 CAGGCAGAGGAGTAGCAATGTGG + Intergenic
1142875708 17:2851138-2851160 AAGACAAAGAATTATGAAGGAGG + Intronic
1143184827 17:5003828-5003850 CTGGAAAAGGATGAGGAATGTGG - Intronic
1143719326 17:8799007-8799029 CAGGTAAAGGGTCAGGAACGGGG + Exonic
1143962037 17:10729366-10729388 GAGGGAAATGATTATGAAGGGGG + Intronic
1145934182 17:28705432-28705454 CAGGGAAAGGATCAAGAAGGGGG - Intronic
1147303642 17:39548884-39548906 CAGGCATGGGGGTAGGAAGGAGG - Intronic
1148480971 17:47959178-47959200 CAGGCAAAGGGTGAGGCACGGGG + Intergenic
1151011544 17:70503816-70503838 CATGCAAAGTACTAAGAAGGGGG - Intergenic
1151946134 17:77320962-77320984 CAGGCAAATGAAGAGAAAGGGGG + Intronic
1153265583 18:3265803-3265825 CAGCCAAAAGAATAGGATGGTGG + Intronic
1155118066 18:22789934-22789956 CAGGAACAGGCTTAAGAAGGAGG + Intergenic
1155628123 18:27860185-27860207 CAGGCAGAGGCTGAGGAAGTCGG - Intergenic
1156256570 18:35403483-35403505 AAAGCTAAGGATTAGAAAGGAGG + Intergenic
1156275004 18:35575925-35575947 TAGCCAAAGGATCAGGAAAGGGG + Intergenic
1156920556 18:42517203-42517225 CTGATAAAGGATTAGGCAGGAGG - Intergenic
1156985172 18:43342259-43342281 CAGAGAAAGGATCAGGAATGGGG - Intergenic
1160246035 18:77160370-77160392 CAGTCACAGCATTAGGAAAGAGG + Intergenic
1161351766 19:3796922-3796944 CAGGCAAAGTATGAGGAAACAGG - Intronic
1161711067 19:5848330-5848352 CAGGCTAAGGGAGAGGAAGGAGG - Intronic
1162193775 19:8967727-8967749 CAGGGAAAGGATTCAGAGGGAGG - Intronic
1164912715 19:32025749-32025771 CAGGGGAAGAATTAGGAAAGAGG - Intergenic
1165249085 19:34515230-34515252 CAGGCTAAGGAAGAAGAAGGAGG - Intergenic
1166499074 19:43327906-43327928 CAGGCTAAGGAAGAAGAAGGAGG + Intergenic
1166567962 19:43776571-43776593 GAGGCAGAGGAGTAAGAAGGTGG + Exonic
1167608200 19:50492902-50492924 GAGGGAAAGGAGGAGGAAGGAGG + Intergenic
1167646519 19:50708593-50708615 CATGGAAAGGATGAGGATGGAGG + Intronic
1168069243 19:53940697-53940719 TGGGCAAAGGTTTCGGAAGGAGG - Intronic
1168097311 19:54123098-54123120 CCAGGAAAGGATTAGGATGGCGG + Intronic
925708421 2:6713414-6713436 CAGGAAAAGGCCTTGGAAGGTGG + Intergenic
926713275 2:15901190-15901212 TAAGCAAAGGATAAGGCAGGTGG + Intergenic
927901992 2:26827118-26827140 CAGCTACAGGATTAGAAAGGAGG - Intergenic
928114093 2:28533973-28533995 GAGACAGAGGATTAGGGAGGTGG - Intronic
929408407 2:41669177-41669199 TAGGGAAAGGAGGAGGAAGGAGG - Intergenic
929474083 2:42227689-42227711 TAGGCAGAGGAGGAGGAAGGGGG - Intronic
929954872 2:46449374-46449396 CAGGCTGTGGATTAGGAAGGGGG - Intronic
930232203 2:48854747-48854769 CAGAAAAAGGAATGGGAAGGGGG - Intergenic
930562622 2:52979681-52979703 GGGGCAAAGCAGTAGGAAGGTGG + Intergenic
931470649 2:62535290-62535312 CAGGGAAAGGATTTGAATGGGGG + Intergenic
931799667 2:65746601-65746623 CAAGCAAAGGATAAGTACGGCGG - Intergenic
932532040 2:72545963-72545985 CAAGGAAAGGATTAGGAGAGTGG - Intronic
934053498 2:88231256-88231278 TAGGCAAAGGATAAGAAAAGGGG - Intergenic
934626916 2:95867080-95867102 CAGGCCATGGTTTTGGAAGGTGG + Intronic
934806643 2:97234210-97234232 CAGGCCATGGTTTTGGAAGGTGG - Intronic
934830866 2:97522965-97522987 CAGGCCATGGTTTTGGAAGGTGG + Intronic
935434790 2:103018222-103018244 CAGCCAAGGGATTAGGTATGAGG - Intergenic
937315240 2:120927992-120928014 CAGGGACAGGGTTAGGCAGGTGG - Intronic
937680661 2:124640818-124640840 CAGGTGAAGGGTTAGGAAGGAGG + Intronic
938099708 2:128490439-128490461 CAGGCAAAGGAGAAGGAGGAAGG + Intergenic
938228693 2:129639370-129639392 CAGCCAAACGACTAGGAACGGGG - Intergenic
938676066 2:133635207-133635229 CAGACAGAGGAAAAGGAAGGGGG + Intergenic
938839378 2:135144228-135144250 CAATCAAAGGGTAAGGAAGGTGG + Intronic
938922356 2:136007015-136007037 TAGGAAAGGGATTGGGAAGGAGG - Intergenic
940622489 2:156129795-156129817 CAGTAAAAGGATTATAAAGGAGG - Intergenic
941219921 2:162765057-162765079 CAGGAGAAGGGTAAGGAAGGAGG + Intronic
942231888 2:173867848-173867870 CAGGCTCAGTATTTGGAAGGGGG - Intergenic
942776991 2:179593888-179593910 CAGGAGAAAGATTATGAAGGGGG - Intronic
943046125 2:182864337-182864359 CAGGCCAAGGGCTAGGAATGAGG - Intronic
947038007 2:225882038-225882060 AAGGTAAAGGATTAAGAAGCAGG + Intergenic
947184011 2:227438759-227438781 CAGCCAAAGGATCAGGAAGGAGG + Intergenic
947219283 2:227777694-227777716 CAGCCAAGGAATTAGGAAGAGGG - Intergenic
947435975 2:230072557-230072579 CAGGCAAAGTTTTATGAAGGAGG + Intergenic
947448135 2:230180201-230180223 CAGGGAAAGGAAAAGCAAGGTGG + Intronic
948401678 2:237690050-237690072 CAGGGAAGGGATTAAGAAGTGGG - Intronic
949086805 2:242162688-242162710 CAGGCAGAGGAGTAGCAATGTGG + Intergenic
1168804007 20:662337-662359 CAGGGGAAGGTTCAGGAAGGTGG + Exonic
1169544638 20:6637999-6638021 CAGGCAATAGGTAAGGAAGGTGG - Intergenic
1169924943 20:10773343-10773365 CATGCAAAAGATGAGGAAAGAGG - Intergenic
1169966369 20:11222245-11222267 TAGGGAAAAGATGAGGAAGGGGG + Intergenic
1170052945 20:12166653-12166675 CATGCATGGGATTTGGAAGGAGG - Intergenic
1170329419 20:15191788-15191810 CAGCTCAAGGATTAGGCAGGAGG + Intronic
1170706499 20:18749010-18749032 CAGGCAAAAGAGGAGGAAGAGGG + Intronic
1170825445 20:19790685-19790707 CACCCAAAGGATAAGGAAGTTGG - Intergenic
1170913464 20:20598766-20598788 CAGGCAAAGCCTCAGAAAGGTGG + Intronic
1172512516 20:35510271-35510293 AAGGGAAAGGAATAGGAAGAGGG + Intronic
1172625963 20:36347036-36347058 CAGGCAAAGCTTCAGGAAGGAGG - Intronic
1172644084 20:36459087-36459109 CAGGCTGGGGATTAGGGAGGGGG + Intronic
1173200784 20:40953640-40953662 CAAGCTAAGGATGAGGAAGTTGG + Intergenic
1173743464 20:45419018-45419040 GAGGCAAAGGTTTGGGCAGGAGG - Intronic
1175122239 20:56724670-56724692 CACTCCAAGGATTAGGAAAGGGG - Intergenic
1175126963 20:56759706-56759728 CAGGCAAAGAAAAAGGCAGGTGG - Intergenic
1176923727 21:14721285-14721307 GAGATAAAGGATTAGGAAAGAGG - Intergenic
1178856466 21:36254378-36254400 CTGGGAAAGGATGAGGGAGGAGG + Intronic
1179109458 21:38433903-38433925 AATTCAGAGGATTAGGAAGGAGG - Intronic
1179768209 21:43590843-43590865 CAGGGAGAGGAGCAGGAAGGAGG + Intronic
1179875106 21:44263105-44263127 CAGGGAAGGGAGCAGGAAGGTGG + Intergenic
1180012983 21:45063640-45063662 AAGGCAAAGAACTTGGAAGGGGG + Intergenic
1180855395 22:19041877-19041899 CAGTGACAGGATGAGGAAGGAGG + Exonic
1181824299 22:25501851-25501873 CAGGCAAAGGACCAAGAAAGAGG - Intergenic
1182522875 22:30894030-30894052 CAGGCAAAGGAGAGGGAAGGAGG + Intronic
1182748851 22:32626026-32626048 CAGGAAAAGCTTAAGGAAGGAGG + Intronic
1184553480 22:45218691-45218713 CAGGCTAAGGATAAGGATGTGGG - Intronic
1184697462 22:46148010-46148032 CAGGGAAAGAATTGGGAAGCTGG - Intergenic
1184881194 22:47305067-47305089 CAGGCCGAGGGTTAGGAAGGTGG - Intergenic
949650246 3:6149760-6149782 TAGCCAAAGGATCAGGAAAGGGG - Intergenic
950115589 3:10448684-10448706 CAGACAAAGCAGTAGGAAGATGG - Intronic
950226123 3:11235849-11235871 CAGCCAAAGGACTGGGAAAGAGG - Intronic
950879216 3:16309009-16309031 TAGGCAAGGGAATAGGATGGGGG - Intronic
952312999 3:32207366-32207388 CATGCAAAGGGTTTGCAAGGAGG + Intergenic
952529154 3:34245313-34245335 CATGCAAAGGATCAGGAATAAGG - Intergenic
952855487 3:37767087-37767109 CACGCAAAGGAAGAGGGAGGAGG + Intronic
952964887 3:38614917-38614939 CAGGGACAGGAGTAAGAAGGTGG + Intronic
953508750 3:43513283-43513305 CTGGGAAATGATTACGAAGGAGG + Intronic
954312791 3:49783306-49783328 CAGGCCAAGGCTGAGGCAGGTGG + Intronic
954542145 3:51400649-51400671 TGGGGAAAGGATAAGGAAGGTGG - Intronic
955318602 3:57958844-57958866 CAGAAAAAGAATGAGGAAGGAGG - Intergenic
955975186 3:64473445-64473467 TAGGAAAGGGATTAGGAAGGAGG - Intergenic
955999989 3:64719511-64719533 TGGGCAAAGGCTTGGGAAGGTGG - Intergenic
956072375 3:65466960-65466982 TAGCCAAAGGATCAGGAAAGGGG - Intronic
956259471 3:67322837-67322859 CAGCCAAAGGACTAGGAAAGGGG - Intergenic
958744713 3:98118824-98118846 GAGGCTATGGATCAGGAAGGTGG + Intergenic
960393317 3:117105899-117105921 GAGGCATATGTTTAGGAAGGCGG - Intronic
962119281 3:132544775-132544797 CAGGCACAGGATAAGACAGGAGG + Intergenic
962257770 3:133884162-133884184 CTGGCAAAGGAATACCAAGGTGG + Intronic
962494589 3:135926507-135926529 CTGGCAAAGGGTTAGGAAAATGG + Intergenic
963584034 3:147161730-147161752 GAGGTTAAGGACTAGGAAGGAGG - Intergenic
965935708 3:174108336-174108358 TAGTCAAAGGATCAGGAAAGGGG - Intronic
966717646 3:183029900-183029922 CAGGCCAAGTATTTGGAATGGGG - Intronic
967151949 3:186658902-186658924 CAGGCTAAGGAAGAAGAAGGAGG - Intergenic
967986753 3:195100878-195100900 CAGGCACAGGGTTAGGCAGCAGG - Intronic
968199534 3:196740208-196740230 CAGGCCACGGAGAAGGAAGGAGG - Intronic
969056580 4:4406411-4406433 AATGCAAAGGGTTACGAAGGAGG + Intronic
970282878 4:14478029-14478051 GAGACAAAGGATTAAGATGGTGG + Intergenic
970652273 4:18192010-18192032 CATGCGAGGGATCAGGAAGGGGG + Intergenic
970775315 4:19667950-19667972 CAGGGAAAGTATTATCAAGGTGG + Intergenic
970856281 4:20652124-20652146 CAGGTAAAGAATTCAGAAGGTGG + Intergenic
971158610 4:24109756-24109778 TAAGCAAAGGGCTAGGAAGGAGG + Intergenic
971366683 4:25983292-25983314 CTGGAAAAGGAGCAGGAAGGAGG + Intergenic
972762363 4:42119438-42119460 CAGGCAGAGGGGTGGGAAGGAGG - Intronic
973547979 4:52001327-52001349 CAGGCAAAGGATGAGCAAGTGGG + Intronic
973949820 4:56000486-56000508 CAGTAAAAGGATGAGGGAGGAGG - Intronic
975040049 4:69735350-69735372 TGGTCAAAGGATTAGGAAAGAGG + Intronic
977566872 4:98589457-98589479 CAGACAAAGGAAAGGGAAGGAGG + Intronic
978814775 4:112891726-112891748 CATGCATAGCATTAGGAAAGAGG + Intronic
979660308 4:123245869-123245891 CAGGCATAGGATTAGGTACTAGG - Intronic
980700896 4:136428697-136428719 CATGCATAGGATAAGGAATGGGG - Intergenic
981941499 4:150286414-150286436 CCCACAAAGGATGAGGAAGGAGG - Intronic
982112309 4:152068004-152068026 AAGGCCAAGGAGTAGGAAGGTGG - Intergenic
982284821 4:153724136-153724158 AAGGAAAAGGATGAGGATGGAGG + Intronic
982724088 4:158887089-158887111 AAAGAAAAGGAATAGGAAGGTGG - Intronic
984715388 4:182919684-182919706 CAGGCAGAGGAGGTGGAAGGAGG - Intergenic
987968043 5:24902408-24902430 CAGGCAAAGGATCACGTGGGAGG + Intergenic
989110378 5:37901745-37901767 CTGGCAAAGGAGTGGGGAGGAGG + Intergenic
989997191 5:50849790-50849812 AGGGCAAAGGGTCAGGAAGGAGG - Intergenic
991515852 5:67434468-67434490 GAAGCAAAAGATAAGGAAGGTGG - Intergenic
993212215 5:84966234-84966256 CAGGCAAAGGACTACGGTGGAGG - Intergenic
993316632 5:86415205-86415227 CAGGCAAAGAAATATGATGGAGG + Intergenic
995555232 5:113321413-113321435 GAGGAAAATGATCAGGAAGGAGG + Intronic
995800860 5:115992709-115992731 CAGGTAATAGATTAGCAAGGTGG + Intronic
997462224 5:134060642-134060664 AAGACAAAGGATGGGGAAGGAGG + Intergenic
997504150 5:134402864-134402886 CAGCTACAGGATTAGAAAGGAGG - Exonic
998359633 5:141573803-141573825 CAGGCAAAGGAGGAGGTGGGGGG + Exonic
999061889 5:148644681-148644703 CAGACAAGGGGATAGGAAGGTGG + Intronic
999090288 5:148930017-148930039 GGTGCCAAGGATTAGGAAGGTGG + Intronic
1000698916 5:164423228-164423250 CAAGCAAAGGATTATAATGGGGG + Intergenic
1001051572 5:168418458-168418480 CAGGCAGAGGATCCAGAAGGTGG - Intronic
1001054269 5:168436273-168436295 AGGGCAAAGGATTTTGAAGGAGG - Intronic
1002198520 5:177513940-177513962 CAGACAAAGAAATAGGAAGGAGG - Intronic
1003413262 6:5884799-5884821 CAGACCTAGGGTTAGGAAGGTGG + Intergenic
1003857740 6:10293234-10293256 CAAGCAAGGCTTTAGGAAGGAGG + Intergenic
1004403247 6:15308127-15308149 CAGGTAAAGGATTAAGGAAGAGG - Intronic
1004836861 6:19540167-19540189 CAGGCTAAGGGATAAGAAGGAGG - Intergenic
1005231312 6:23704645-23704667 CAGGGGAAGGAGTAGGAGGGAGG + Intergenic
1005947520 6:30605131-30605153 CAGGTGTAGGATTATGAAGGAGG - Intronic
1006655851 6:35592308-35592330 CAGGCAAAGGGTAAAGAAAGTGG - Intronic
1007228048 6:40328544-40328566 CAGGGAAATGCTTAGGCAGGAGG - Intergenic
1007258532 6:40545586-40545608 CAGGCAGAGGAAGAGGAAGAGGG + Intronic
1007511536 6:42378035-42378057 GAGGCAAGGGATTGGGAAGGGGG + Intronic
1008547145 6:52593345-52593367 TAGGCAAAAGTTTAGGGAGGAGG - Intergenic
1009534559 6:64863872-64863894 CAGGGAAGGTATTAGAAAGGAGG - Intronic
1011170179 6:84496876-84496898 CAGGGAAAGGGTTAGAAAGATGG + Intergenic
1011219018 6:85034655-85034677 CAGGGAAAGGATATGGTAGGTGG - Intergenic
1011651814 6:89513362-89513384 CAGGTTAAGGATTGGGAGGGGGG - Intronic
1013206981 6:107954036-107954058 CAGGGAAAGGATTGGGAAATCGG + Intronic
1013491543 6:110651087-110651109 CAGGCAAAGGGTTGGGAAGGGGG + Intronic
1015106479 6:129542587-129542609 CAGGGAAAGGATTGGGGAGATGG - Intergenic
1015154275 6:130074563-130074585 CAGGCAGATAATCAGGAAGGAGG - Intronic
1017665258 6:156713752-156713774 GAGGCAAAGGAGGAGGGAGGAGG + Intergenic
1017778583 6:157698816-157698838 CAGGCAAAGGCTTGGGAAGTGGG + Intergenic
1018655778 6:166034248-166034270 CAGGCAAGGGACTGGGACGGAGG + Intergenic
1019079733 6:169422164-169422186 CATGCAGAGGAATAGGTAGGAGG - Intergenic
1020595583 7:10203461-10203483 AAGCCAAAGGATAAGGAAAGTGG - Intergenic
1021310582 7:19091007-19091029 CAGGCACAGAATTGGAAAGGAGG + Intronic
1021599878 7:22354960-22354982 CCATCAAAGGAGTAGGAAGGGGG - Intronic
1021776360 7:24058907-24058929 CAGGCATAGCATGAGGAAGATGG + Intergenic
1021981388 7:26058980-26059002 TAGGCAGAGGATTAGGAATGTGG + Intergenic
1022028358 7:26469123-26469145 CAGTCAAAGGATTGGGAAGGGGG - Intergenic
1022124390 7:27341490-27341512 CAAGCAGAGGATAAGGAATGCGG + Intergenic
1022821658 7:33968213-33968235 CAGGCAAGGTTTTAGAAAGGAGG - Intronic
1023056231 7:36292110-36292132 CAGGAAACTGATCAGGAAGGGGG + Intronic
1023249215 7:38239443-38239465 CAGGGAAAGAATTAGAAATGGGG + Intergenic
1023250861 7:38259507-38259529 CAGGGAAAGAATTAGAAATGGGG + Intergenic
1023648218 7:42341441-42341463 CAGAAAAAGGATAAGGAAGAAGG - Intergenic
1023861582 7:44220360-44220382 GAGGGAAAGGATTAGGCTGGTGG - Intronic
1024055831 7:45659360-45659382 CAGGGAATGGTTTTGGAAGGTGG + Intronic
1026413492 7:70153418-70153440 CAGGCACAGAATTGGGAGGGAGG + Intronic
1028399037 7:90404668-90404690 CGGTGAAAGGATAAGGAAGGTGG - Intronic
1028419656 7:90618597-90618619 CAGGCAAGGGAAGATGAAGGGGG + Intronic
1030095433 7:105894571-105894593 CAGGCAATGGACTGGGAAGATGG + Intronic
1032879278 7:136071895-136071917 CAGGAAAGGGATTGGCAAGGTGG - Intergenic
1034537234 7:151733056-151733078 CAGGCACAGGCTTGGGAGGGAGG + Intronic
1035497904 8:68581-68603 CAGGCAGAGGAGTAGCAATGTGG - Intergenic
1035920214 8:3668299-3668321 AAGTGAGAGGATTAGGAAGGAGG + Intronic
1036050854 8:5195147-5195169 CAGGCAAAAGATGTGGCAGGGGG - Intergenic
1036792780 8:11733489-11733511 CAGCCAAGGTATTAGGAATGGGG + Intronic
1037859769 8:22396881-22396903 CAGGCAAGGAAAAAGGAAGGAGG - Intronic
1039121012 8:34146364-34146386 CAGTCAAAGGATGAAGAAAGGGG + Intergenic
1039348981 8:36740396-36740418 TAGTCAAAGGATCAGGAAAGGGG - Intergenic
1040070369 8:43182224-43182246 CAGGCACAGGTTTAGCAAAGAGG - Exonic
1040946197 8:52886905-52886927 GATGCATAGGATTAGGAATGGGG - Intergenic
1041511451 8:58659149-58659171 AAGGGGAAGGATTAGAAAGGGGG + Intronic
1043267391 8:78283551-78283573 CAGGGCAAAGAATAGGAAGGAGG - Intergenic
1044387019 8:91601187-91601209 CAGGCAAAGGGTTAGATAGAGGG + Intergenic
1044416946 8:91949293-91949315 CAGGCTAAGGAAGAAGAAGGAGG - Intergenic
1045004392 8:97905184-97905206 AATGCAAAGGATTAGAAAGGAGG - Intronic
1045097757 8:98816164-98816186 CAGGAAAAGGAAAAGGATGGAGG + Intronic
1045159204 8:99518573-99518595 AAGGCAAAATAGTAGGAAGGTGG - Intronic
1045427110 8:102078084-102078106 CAGGGAAAGGGTCAGGATGGGGG - Intronic
1047210585 8:122836904-122836926 AAGGCACAGGATGAGGTAGGAGG + Intronic
1047480223 8:125275162-125275184 CAGGAAAAGGATATGGAAGGGGG - Intronic
1047962166 8:130018284-130018306 CAGGAAAAGGGTTTGGAAGCAGG + Intergenic
1048168582 8:132084673-132084695 CAGGCTAAGGGATAAGAAGGAGG + Intronic
1048266225 8:132989677-132989699 CAGGCAAAGGCACAGGATGGAGG - Intronic
1048750604 8:137669666-137669688 CAGTCAAAGGATGAGGAAAGGGG + Intergenic
1049282166 8:141755202-141755224 AAGGGCAACGATTAGGAAGGAGG - Intergenic
1050856723 9:10366914-10366936 CAGGATAATGATTAGGAAGAAGG + Intronic
1051105744 9:13577950-13577972 CAGGCAATGGGTGAGGAAGTGGG + Intergenic
1051211744 9:14752282-14752304 AAGTGAAAGGATTAGGAGGGAGG + Intronic
1052108322 9:24547121-24547143 CAGGCAATGTATTAGAAAAGAGG - Intergenic
1052558994 9:30059474-30059496 CATGGAAAGTATTAAGAAGGAGG - Intergenic
1052593685 9:30531423-30531445 TAGGCATAGGATGAGGCAGGAGG + Intergenic
1053393767 9:37753980-37754002 AAGGGAAAGTATCAGGAAGGTGG - Intronic
1057236378 9:93365233-93365255 CAGGCATGGGATTAGCAAGTAGG + Intergenic
1057597540 9:96428049-96428071 CAGTTAAAGGATCAGGAAGTGGG + Intergenic
1058144972 9:101400430-101400452 GAGACAAAGGATGGGGAAGGAGG - Intronic
1058346355 9:103967987-103968009 CTGGGAATGGATTAAGAAGGAGG + Intergenic
1059072417 9:111152799-111152821 GAGGCAGAGGAGGAGGAAGGAGG + Intergenic
1060384901 9:123216162-123216184 CAGGCAAAGGATTAGGAAGGGGG - Intronic
1060455744 9:123794174-123794196 CAGGAAAAGGACTAGGCTGGCGG + Intronic
1060582527 9:124763642-124763664 AAAGCAAGGGATGAGGAAGGGGG + Intronic
1060654344 9:125358758-125358780 TAGGCATAGGATAAGGAATGGGG + Intronic
1061818032 9:133207832-133207854 GAGGCCAAGGATTAGGTACGGGG - Intronic
1062196563 9:135277309-135277331 CAGGCAATGGTTTAGGCACGAGG - Intergenic
1185684552 X:1917641-1917663 CAGGCAAAAGAAAAAGAAGGGGG + Intergenic
1186071052 X:5821189-5821211 TAGGCAGAGGAGTAGGATGGGGG - Intergenic
1186451431 X:9677090-9677112 GAGGCCAAGGATGAGGAAGTGGG - Intronic
1186684592 X:11912175-11912197 CAGGCAAAGGAAAAGAAAAGAGG - Intergenic
1187813933 X:23210684-23210706 AAGGAAAAGGATTAGGGAGAAGG + Intergenic
1188197260 X:27251716-27251738 CAGCCAAAAGACTAGGAAAGGGG - Intergenic
1188505230 X:30875301-30875323 TAAGCAAAGGATTAGGAAACTGG - Intronic
1188779603 X:34265011-34265033 CAGGAGAAGGATGAGGAAAGGGG + Intergenic
1189181704 X:39010771-39010793 CAGCAAAAGGATTATGCAGGAGG + Intergenic
1189552016 X:42102916-42102938 CTGCCAAGGGATTAGGAAGCTGG - Intergenic
1190384231 X:49868770-49868792 TAGGCAAAGGAACAGGAAAGGGG - Intergenic
1191661490 X:63656201-63656223 CTGGCAAAGGATTACCTAGGGGG + Intronic
1191776864 X:64823916-64823938 CAGCCAAAGGACCAGGAAAGGGG + Intergenic
1192318025 X:70067026-70067048 CAGGCGAAGGCTGTGGAAGGAGG + Intergenic
1192706795 X:73534481-73534503 AAGGCAAAGGAGGAGCAAGGTGG - Intergenic
1193097306 X:77564781-77564803 CAGCCAAAGGACCAGGAAAGGGG + Intronic
1196315270 X:114214629-114214651 CAGGCAAATGTATAGGAACGTGG - Intergenic
1198075098 X:133186339-133186361 CAGGGAAAGGAGCAGGAAAGAGG + Intergenic
1199490720 X:148397495-148397517 TAGGCATAGGAAGAGGAAGGAGG + Intergenic
1199600061 X:149536572-149536594 GAGGCAAAGGAAGAGGAAGGCGG + Intergenic
1199650521 X:149943368-149943390 GAGGCAAAGGAAGAGGAAGGCGG - Intergenic
1199692872 X:150321952-150321974 TAGCCAAAGGACTAGGAAAGGGG + Intergenic
1199830071 X:151540356-151540378 CAGCCAAAGGACCAGGAAAGGGG - Intergenic
1201559613 Y:15302129-15302151 CAGGCAGGGGATTAGGAAATGGG - Intergenic
1201731640 Y:17210854-17210876 CAGGCAAAGGAGCTGGAAGGGGG - Intergenic