ID: 1060385118

View in Genome Browser
Species Human (GRCh38)
Location 9:123218770-123218792
Sequence ATTATGATTAACCATGTGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060385115_1060385118 4 Left 1060385115 9:123218743-123218765 CCCATATATATTCTATTAGTGAC 0: 1
1: 0
2: 0
3: 18
4: 178
Right 1060385118 9:123218770-123218792 ATTATGATTAACCATGTGCCAGG No data
1060385116_1060385118 3 Left 1060385116 9:123218744-123218766 CCATATATATTCTATTAGTGACT 0: 1
1: 0
2: 3
3: 25
4: 262
Right 1060385118 9:123218770-123218792 ATTATGATTAACCATGTGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060385118 Original CRISPR ATTATGATTAACCATGTGCC AGG Intronic
No off target data available for this crispr