ID: 1060387459

View in Genome Browser
Species Human (GRCh38)
Location 9:123245136-123245158
Sequence GTGGATTCACATGCTGTTGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 174
Summary {0: 1, 1: 2, 2: 5, 3: 27, 4: 139}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060387459_1060387462 14 Left 1060387459 9:123245136-123245158 CCTACAACAGCATGTGAATCCAC 0: 1
1: 2
2: 5
3: 27
4: 139
Right 1060387462 9:123245173-123245195 AAAAGTTTTATAAACTCCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060387459 Original CRISPR GTGGATTCACATGCTGTTGT AGG (reversed) Intronic
901052000 1:6429947-6429969 GTCGAGTCACATGCTGCTGTGGG - Intronic
901082259 1:6590185-6590207 GTGGATTCACAGCCTGGTTTGGG + Intergenic
901804370 1:11728899-11728921 ATGGACACACATGCTGTGGTGGG + Intergenic
902482233 1:16718067-16718089 GTCGAGTCACATGCTGCTGTGGG + Intergenic
905088506 1:35406856-35406878 GTGGATCAACATGTTGTAGTAGG + Intronic
905988173 1:42307176-42307198 CTGGATTCACTTGTTGCTGTTGG - Intronic
908819155 1:68065642-68065664 GAAGATTCACATGCAATTGTAGG - Intergenic
909205754 1:72755448-72755470 GTTGGTTCACGTGCAGTTGTAGG - Intergenic
910294993 1:85635579-85635601 GTGAATTCACCTGTAGTTGTTGG - Intergenic
911799512 1:102118043-102118065 CTGGATTAACATGGTGTTGAAGG - Intergenic
914506131 1:148290555-148290577 GTAGATTCACATGGAGTTATAGG - Intergenic
916074670 1:161193534-161193556 GTTGATTCCCCTGCTGCTGTGGG - Intronic
918449180 1:184642414-184642436 GTTGATTCAAAGGCTGTTCTAGG - Intergenic
919775933 1:201194074-201194096 GTGGATGCCCATTCTGTTGAAGG + Intronic
922201802 1:223409419-223409441 ATGGTTTCACATGCAGTTTTAGG - Intergenic
922965989 1:229691242-229691264 GTGGCTTAACATCCTATTGTAGG + Intergenic
1062923239 10:1295838-1295860 GTTGATTCACAGACTGTAGTAGG + Intronic
1063266645 10:4458798-4458820 GTGGAGTCACTTGCTGGTGAGGG - Intergenic
1068308746 10:55251005-55251027 GACAATTCACATGCAGTTGTAGG + Intronic
1068761938 10:60722141-60722163 GTGGATTGAAAAGCTGCTGTGGG - Intronic
1070996043 10:80783630-80783652 GTGGATTCACATGCAGTTGTAGG + Intergenic
1072031115 10:91523485-91523507 GTGTTTTGACTTGCTGTTGTTGG - Intergenic
1072417213 10:95259224-95259246 GTAGATTCACTTGCAGTTATAGG - Intronic
1074144329 10:110703060-110703082 GTAGATTCAGATGCACTTGTAGG + Intronic
1076041978 10:127258052-127258074 GTGGGTTCATGTGCAGTTGTAGG + Intronic
1076377323 10:130000336-130000358 GTAGGTTCACATACAGTTGTAGG - Intergenic
1078343866 11:10525745-10525767 GTAGAATCTCATGCGGTTGTTGG - Intronic
1079152064 11:17908882-17908904 GTGGCTTCTCATGCTGATGACGG - Intronic
1079395613 11:20060544-20060566 GTGGATGTACATGCTGATATAGG + Intronic
1083031165 11:59593828-59593850 TGGGATTCACCTACTGTTGTGGG - Intronic
1087005333 11:93465240-93465262 GTATTTTCACATGCAGTTGTAGG - Intergenic
1089541018 11:119188992-119189014 CTGGAGTCACCTGGTGTTGTGGG - Exonic
1090800665 11:130169730-130169752 GTAGATTCCCATACAGTTGTAGG - Intronic
1091801753 12:3328833-3328855 GTGGAGTCCCATGCTCATGTGGG - Intergenic
1094292238 12:28864531-28864553 GTGGCTTTAAAAGCTGTTGTAGG - Intergenic
1095254280 12:40015702-40015724 GTGGATATACATGCTGATGAAGG - Intronic
1097969910 12:65622343-65622365 GTGGATGCAAATGCTTTTATAGG + Intergenic
1099838064 12:87932902-87932924 CTGGATTCAGTTGCTGTTATGGG - Intergenic
1100087582 12:90930353-90930375 GTCTATTCATATCCTGTTGTGGG - Intronic
1101134766 12:101731380-101731402 GAGGATTCAAATGGTTTTGTTGG - Intronic
1101814170 12:108132368-108132390 GTGCATTCTCATGCAGGTGTGGG + Intronic
1102420208 12:112797415-112797437 CTGGATTTACATTCTGTTGGGGG + Intronic
1106658217 13:31770255-31770277 TTGGTTTCACAAGCTGTAGTTGG - Intronic
1107032833 13:35870705-35870727 GTGGATTCTAGTGCTGGTGTTGG - Intronic
1107328873 13:39275176-39275198 TTCTATTCACAGGCTGTTGTGGG - Intergenic
1108197299 13:48007785-48007807 ATAGGTTCACATGCAGTTGTAGG - Intergenic
1108693470 13:52881397-52881419 GTCGAGTCACATGCCTTTGTGGG - Intergenic
1112230089 13:97581076-97581098 GTAGATTCACATGCAGTTGTAGG - Intergenic
1113471382 13:110549150-110549172 GTGGACTCACAAGATGTTGATGG - Intronic
1115744759 14:36425095-36425117 TTGGATGCACATGCTTTTGTGGG - Intergenic
1117535883 14:56702969-56702991 GTAGACTCACATGCAGTTGTAGG - Intronic
1117788449 14:59312459-59312481 AAGGATTCAAATGCTGTTGGTGG + Intronic
1118746223 14:68775463-68775485 GGGGCTGCAGATGCTGTTGTTGG + Intergenic
1124574887 15:30898465-30898487 GTAGATTCACATGAAGTTGTAGG + Intergenic
1126255737 15:46623173-46623195 GTGGACTCACATCCTGTTTTGGG + Intergenic
1126326057 15:47478970-47478992 GGGATTTCACATGCTGTTCTCGG - Intronic
1127334119 15:57966880-57966902 GTGGAGTCGCATCCTGTTGTAGG - Intronic
1128934028 15:71730314-71730336 GTGGATTCTCATTCTGCTGCTGG + Intronic
1129593975 15:76944685-76944707 GTGGATCAACATGTTGTTGCAGG + Intronic
1131567283 15:93497883-93497905 ATGGATGAACATGCTGTGGTAGG + Intergenic
1134687514 16:16169237-16169259 GTAGATTCACATGCAGTTCTAGG - Intronic
1138013749 16:53410827-53410849 GTAGATTCACATGAAGTTGTAGG - Intergenic
1144454469 17:15407604-15407626 GTAGATTCACATGCAGTTATAGG - Intergenic
1146627802 17:34447249-34447271 GAGGCTTCCCATGCTGTGGTTGG + Intergenic
1146768468 17:35546206-35546228 GTGCATTGACATTCTGATGTAGG - Intergenic
1148091974 17:45028057-45028079 GTGAATGCACATGCAGGTGTCGG + Intronic
1150628072 17:66856352-66856374 GTAGATTCACATGCAGTTGTTGG + Intronic
1151882079 17:76902082-76902104 GTGGGCGCACATGCAGTTGTGGG + Intronic
1152576605 17:81143932-81143954 CTGGGTGCACCTGCTGTTGTGGG - Intronic
1153672123 18:7421468-7421490 GGGGATTTAGATGCAGTTGTTGG - Intergenic
1154059754 18:11048095-11048117 GAGGTGTCACATGCTGTTGGTGG - Intronic
1155884795 18:31194922-31194944 GTGGTTTCACATACTGTTTATGG - Intergenic
1163301675 19:16451258-16451280 GTAGACTCACTTGCAGTTGTTGG - Intronic
1163643138 19:18473199-18473221 GTGGATTCACAGGCTGGTGGTGG - Intronic
1164928483 19:32151463-32151485 GTAGATTCATGTGCAGTTGTAGG - Intergenic
1166208326 19:41288161-41288183 GTGGGTTCACATGCTGGGGAGGG - Intronic
1166715540 19:44964882-44964904 GTGGGTTCACATGCTATTCCTGG + Intronic
1168570354 19:57462491-57462513 ATAGATTCACAAGCAGTTGTAGG + Intronic
925519549 2:4727120-4727142 GTGATTTCACATGCTCTTTTGGG - Intergenic
925530234 2:4851061-4851083 GTGGATACACATTGTCTTGTAGG + Intergenic
925861224 2:8177786-8177808 GTAGTTTCACATGCAGTTGCAGG - Intergenic
926607222 2:14909604-14909626 ATCGTCTCACATGCTGTTGTAGG + Intergenic
927990931 2:27446470-27446492 CTGGATTCTCAAGCTGTTCTGGG + Exonic
928348960 2:30529229-30529251 GTGGATTAAAATGATTTTGTTGG + Intronic
928878685 2:36071913-36071935 GTGGATGCACTTCCTGTTGGAGG + Intergenic
933262634 2:80147442-80147464 ATGGATATAAATGCTGTTGTTGG + Intronic
933986865 2:87599414-87599436 GCGCTTTCACATGCTGTTGTTGG + Intergenic
934517062 2:94995326-94995348 GTGGATTCTCATAGTGTTGTGGG - Intergenic
934559482 2:95305347-95305369 GTAGATTCACATGCAGTTGCAGG + Intronic
935415037 2:102806380-102806402 CTGGATTCACCTTCTGTTCTTGG + Intronic
936306979 2:111351394-111351416 GCGCTTTCACATGCTGTTGTTGG - Intergenic
937108896 2:119346955-119346977 GTAGATTCACATGTAGATGTAGG - Intronic
937297090 2:120815968-120815990 GTGGATGCACATGGGGTTGGAGG + Intronic
938682845 2:133709788-133709810 GTGGAGTCATATGCATTTGTGGG + Intergenic
941036407 2:160573800-160573822 GTACATTCACATGCAATTGTAGG - Intergenic
941084979 2:161107012-161107034 GTGGATTCATATACTGCTTTGGG + Intergenic
941780504 2:169439447-169439469 GTGGATGCACATGGAGCTGTTGG - Intergenic
942534398 2:176948282-176948304 GAGGAGTCACATACTGTGGTAGG - Intergenic
943404954 2:187470498-187470520 TAGGATTCACCTGCTGTTCTTGG - Intronic
948689980 2:239695825-239695847 GTAGATTCACATGCAGTTGCAGG + Intergenic
1169833931 20:9856378-9856400 GTGGATACACAGACTTTTGTTGG + Intergenic
1172285239 20:33735659-33735681 GTAGATTCACATGCAGTTGTGGG + Intronic
1172450194 20:35016927-35016949 GTACATTCACACGCTGTTGGTGG + Intronic
1174567674 20:51478505-51478527 CTGGATTCACATGGAGCTGTAGG - Intronic
1175811111 20:61857702-61857724 GTAGAGTCACATGCAGTTGTAGG + Intronic
1176206163 20:63889322-63889344 GTAGACTCACATACAGTTGTGGG + Intronic
1177358684 21:20040942-20040964 GTGGAAGCACATGCCTTTGTGGG - Intergenic
1178487902 21:33030414-33030436 TTGGATTCACATGGCGCTGTTGG - Intergenic
1178489182 21:33037173-33037195 GTGGAATCATATTCTGTTGTGGG + Intergenic
1178906313 21:36639869-36639891 GAGGCTACACATGCTGATGTCGG - Intergenic
1185091179 22:48774801-48774823 GTAGATTCACATGCGGTTGTAGG + Intronic
953486106 3:43298240-43298262 TGGGATTCAAATGCAGTTGTTGG + Intronic
953544718 3:43855984-43856006 GTGGATTCACCAGCTGCTTTTGG - Intergenic
956258236 3:67307562-67307584 GGGGCATCACATGGTGTTGTAGG + Intergenic
957984192 3:87551449-87551471 GTGGTTTCTCTTGCAGTTGTAGG + Intergenic
960243843 3:115377783-115377805 GTAGGTTCACATGCAATTGTAGG + Intergenic
960821722 3:121740346-121740368 GTAGAGTCACATGCAGTTGTAGG - Intronic
964091991 3:152888255-152888277 GTGGCTCCACATTCTGTTGGGGG + Intergenic
965099666 3:164279095-164279117 ATGGATTCACCAGCTGTTGATGG + Intergenic
966158434 3:176943529-176943551 GTGTATTCACTTGGTGATGTAGG - Intergenic
966703147 3:182878552-182878574 GTTGATTTACATTCTGGTGTAGG + Intronic
969701848 4:8771952-8771974 GTGGACTCACAGGCTGTGGAGGG - Intergenic
974451106 4:62061300-62061322 GTAGATTCACATGCTGTTGTAGG + Intronic
976991515 4:91372953-91372975 GAGGATCCACATCCTGATGTAGG - Intronic
979808224 4:125001925-125001947 GTGGATTCACATGATTATATTGG - Intergenic
980119101 4:128709385-128709407 GTGGATTCAGCTGCTGCTATGGG + Intergenic
982153753 4:152494420-152494442 GTGGATTCCCATGCAGTATTAGG + Intronic
982746746 4:159111792-159111814 GTAGATTCACATACAATTGTAGG + Intronic
982771513 4:159401252-159401274 GTGGATGCACATGATTTTGTGGG + Intergenic
984769450 4:183424583-183424605 GGGGAGTCATTTGCTGTTGTAGG + Intergenic
988409771 5:30872115-30872137 GTGGATTCACAGAGTGTTTTAGG - Intergenic
988704858 5:33715380-33715402 GAGAATTCATATGCAGTTGTGGG + Intronic
988723126 5:33898911-33898933 GTCCATTGACATGCAGTTGTTGG - Intergenic
993666698 5:90707223-90707245 GTGGAATCTCATGTTGTTTTGGG + Intronic
995384207 5:111570601-111570623 GAGTATTCATCTGCTGTTGTGGG - Intergenic
996691711 5:126347465-126347487 CTGGATCTAAATGCTGTTGTAGG - Intergenic
996715517 5:126584709-126584731 GTGGATTCACGGTCTGTTTTGGG + Intronic
998014439 5:138721129-138721151 GTGCATACACATGTTGTTGGGGG + Intronic
1000343248 5:160293974-160293996 GTGGATTCCCGGGCTCTTGTTGG - Intronic
1005756742 6:28931800-28931822 GTAGATTCACATACAGTTATAGG - Intergenic
1007010188 6:38409285-38409307 GTTAATTCACATTATGTTGTAGG - Intronic
1007734427 6:43971880-43971902 GTGGATCCACAGGGTGCTGTTGG + Intergenic
1007843254 6:44733825-44733847 GGGGATTCACCAGCTGTGGTAGG + Intergenic
1014494484 6:122103919-122103941 ATAGATTCACATGCAGTTGTAGG - Intergenic
1016141345 6:140615121-140615143 GTAGATTCACATGCTATTGTAGG + Intergenic
1018323069 6:162634108-162634130 GTGAATGCACAGGCTGTTCTGGG - Intronic
1020067508 7:5200365-5200387 ATGGATTCACATGTAGTTGCAGG + Intronic
1024104479 7:46068250-46068272 GTGAATTCCCATGCAGCTGTAGG + Intergenic
1024735414 7:52299481-52299503 GTAGATTCACATGTATTTGTAGG + Intergenic
1026627239 7:72006092-72006114 GTAGACTCACATGCAGTTGTAGG - Intronic
1035643690 8:1202381-1202403 GTGGACGTCCATGCTGTTGTGGG + Intergenic
1037560211 8:20066685-20066707 GTACATTCACATGCTGTTACAGG - Intergenic
1038777359 8:30543096-30543118 GTGGTTTAACATACTGTTGCTGG - Intronic
1039751519 8:40482882-40482904 GTGGATTCTCATACTGCTGCAGG + Intergenic
1041782168 8:61589080-61589102 GTGGCTTCAGAGGCTGTGGTGGG + Intronic
1041800409 8:61791873-61791895 GTTGATTCAAATGCACTTGTGGG + Intergenic
1049426548 8:142540460-142540482 GTGGATCCACATGCAGCTGGTGG + Intronic
1051448943 9:17173798-17173820 GTAGATTCACATGCAGTTACAGG + Intronic
1053136664 9:35655121-35655143 GTGCATGCACGTGATGTTGTGGG - Intergenic
1053891781 9:42701084-42701106 GTGAATTCTCGTGCTGTTTTCGG - Intergenic
1055761512 9:79613905-79613927 CTGAATTCACATGCTCTTTTGGG + Intronic
1058035060 9:100242739-100242761 GTAGATTCATATGTAGTTGTAGG + Intronic
1058673780 9:107382760-107382782 GCGTATTCACACACTGTTGTTGG - Intergenic
1060387459 9:123245136-123245158 GTGGATTCACATGCTGTTGTAGG - Intronic
1060773359 9:126348765-126348787 GTAGACTCACATGCAGTTGTAGG + Intronic
1062553531 9:137102077-137102099 GTGGTGTTACATGCTGTTGCAGG + Intronic
1186330185 X:8524142-8524164 GTAGATTCACATGCAATTGTAGG - Intergenic
1191920369 X:66249824-66249846 GTGGATTCTGATGCTGCTGGTGG + Intronic
1193410401 X:81156046-81156068 ATGGATTCATATGGAGTTGTAGG - Intronic
1193896798 X:87124534-87124556 GTAGTTTCACATACAGTTGTAGG - Intergenic
1194349489 X:92808600-92808622 GTGGATTCATGTGCTGGTGTGGG - Intergenic
1195740200 X:108057538-108057560 GTAGATTCACATGCAGTTCTAGG - Intronic
1195917759 X:109952523-109952545 GTGGATTCACATGCCTTGGGGGG + Intergenic
1200657811 Y:5925201-5925223 GTGGATTCATGTGCTGGTGTGGG - Intergenic