ID: 1060387459

View in Genome Browser
Species Human (GRCh38)
Location 9:123245136-123245158
Sequence GTGGATTCACATGCTGTTGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060387459_1060387462 14 Left 1060387459 9:123245136-123245158 CCTACAACAGCATGTGAATCCAC No data
Right 1060387462 9:123245173-123245195 AAAAGTTTTATAAACTCCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060387459 Original CRISPR GTGGATTCACATGCTGTTGT AGG (reversed) Intronic