ID: 1060388961

View in Genome Browser
Species Human (GRCh38)
Location 9:123262332-123262354
Sequence ATATGTCAACAGCACTATAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060388959_1060388961 2 Left 1060388959 9:123262307-123262329 CCCTTTAGGACAATTACTAGTCA 0: 1
1: 0
2: 0
3: 8
4: 90
Right 1060388961 9:123262332-123262354 ATATGTCAACAGCACTATATTGG No data
1060388960_1060388961 1 Left 1060388960 9:123262308-123262330 CCTTTAGGACAATTACTAGTCAC 0: 1
1: 0
2: 0
3: 5
4: 93
Right 1060388961 9:123262332-123262354 ATATGTCAACAGCACTATATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060388961 Original CRISPR ATATGTCAACAGCACTATAT TGG Intronic
No off target data available for this crispr