ID: 1060389626

View in Genome Browser
Species Human (GRCh38)
Location 9:123267699-123267721
Sequence GCCACCGGGACGCCCGTGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 37
Summary {0: 1, 1: 0, 2: 1, 3: 0, 4: 35}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060389626_1060389633 10 Left 1060389626 9:123267699-123267721 CCCTTCACGGGCGTCCCGGTGGC 0: 1
1: 0
2: 1
3: 0
4: 35
Right 1060389633 9:123267732-123267754 CCCGCCCCACTCCCTGCCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060389626 Original CRISPR GCCACCGGGACGCCCGTGAA GGG (reversed) Intronic
906247974 1:44290379-44290401 GCCACAGGGACACCTGTGAGGGG + Intronic
913192676 1:116426626-116426648 GCCATAGGGATGCCCGTGGAAGG - Intergenic
1075332082 10:121581144-121581166 GCCGCCGGGATGCCCTTGACCGG + Intronic
1084327092 11:68406730-68406752 GCCTCCTTGACGCCCGTGAGCGG - Exonic
1085388545 11:76170755-76170777 GCCACAGGGCCCCCCCTGAATGG - Intergenic
1113909266 13:113834504-113834526 GCCCCCGGAACCACCGTGAAGGG + Intronic
1136564533 16:31062016-31062038 GCCACCAGCGCGCCCATGAAGGG - Exonic
1142619379 17:1154998-1155020 GCCCCCAGGGCGCCCGGGAAGGG - Intronic
1145046110 17:19617554-19617576 GCCAGCGGGACACACCTGAAAGG + Intergenic
1161353928 19:3808871-3808893 GCCACAGGGACGCTCCTGACAGG - Exonic
1162460379 19:10810992-10811014 ACCACCAGGCAGCCCGTGAATGG + Intronic
1166831439 19:45641996-45642018 CCCACCAGGACGCCCCTTAATGG - Exonic
1166909660 19:46143758-46143780 GCCACAGGGAAGCCCTTGGAGGG - Intronic
938590230 2:132728808-132728830 GCCACCGGGACCCAGGTGAGGGG - Exonic
940749604 2:157611493-157611515 GCCACCTGGAGGCCCAAGAATGG - Intronic
948559905 2:238845913-238845935 GCCCCGGGGACGCCCTGGAAGGG - Intergenic
1171011103 20:21510029-21510051 GCCCCGGGCACGCCCGGGAAGGG - Intergenic
1179811333 21:43872465-43872487 GCCACCGCGCCGGCCGTAAATGG + Intronic
1180223634 21:46376011-46376033 CCCACCAGGACGCCCGGGCATGG - Intronic
1180613830 22:17114641-17114663 GCCAGTGGGACACCCGTGCAGGG - Exonic
1182270474 22:29150179-29150201 GCCACCAGGCCTCCCCTGAATGG + Intronic
1184655708 22:45941070-45941092 CCCACCGGGAGGCCTGTGCAAGG + Intronic
954717673 3:52534370-52534392 GGCACCGGGAAGCGCGGGAAGGG - Intronic
986661577 5:10064718-10064740 GCCACCAGGAGGACCCTGAAGGG - Intergenic
997456183 5:134019207-134019229 GACACAGGGAAGGCCGTGAAGGG + Intergenic
997664584 5:135619959-135619981 GCCACCTGGAGGCCCAAGAATGG - Intergenic
1005480821 6:26253851-26253873 GCCACCGCGCCGGCCGTGAGAGG - Intergenic
1013575791 6:111482912-111482934 GCTGCCGGGTCGCCAGTGAAGGG - Exonic
1018124177 6:160665952-160665974 GCCACCGGGACACCCCAGGAGGG + Intergenic
1042007817 8:64201894-64201916 GCCACCTGGACCACCATGAATGG + Intergenic
1049345100 8:142134495-142134517 GCCACCAGGACCCGCGTGCACGG + Intergenic
1049709952 8:144058979-144059001 GGCACCGGGACGCCTGTGAAAGG - Exonic
1060309728 9:122448502-122448524 CCCAGCCTGACGCCCGTGAAGGG - Intergenic
1060389626 9:123267699-123267721 GCCACCGGGACGCCCGTGAAGGG - Intronic
1061482630 9:130904535-130904557 GCCCCAGGCACGCCCGAGAAGGG - Intronic
1062080549 9:134621211-134621233 GGCAGCTGGACGCCCGTCAAGGG + Intergenic
1190517819 X:51243208-51243230 GCCACCTGGAAGCCCAAGAATGG - Intergenic