ID: 1060389627

View in Genome Browser
Species Human (GRCh38)
Location 9:123267700-123267722
Sequence GGCCACCGGGACGCCCGTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 86
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 82}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060389627_1060389633 9 Left 1060389627 9:123267700-123267722 CCTTCACGGGCGTCCCGGTGGCC 0: 1
1: 0
2: 0
3: 3
4: 82
Right 1060389633 9:123267732-123267754 CCCGCCCCACTCCCTGCCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060389627 Original CRISPR GGCCACCGGGACGCCCGTGA AGG (reversed) Intronic
900678087 1:3900913-3900935 GGCGGGCGGGACGTCCGTGAGGG + Intergenic
903867467 1:26410104-26410126 GGACACTGGGAAGCCCGGGATGG - Intergenic
904604457 1:31691211-31691233 GGCCACCTGGATCCCCCTGAGGG + Exonic
906247973 1:44290378-44290400 TGCCACAGGGACACCTGTGAGGG + Intronic
908501084 1:64744831-64744853 CGCCACCCGGACACCTGTGAGGG - Intergenic
1067278467 10:44854020-44854042 GGCCAGCGGAAGCCCCGTGAAGG + Intergenic
1069636146 10:69926065-69926087 GGCCACCTGGATGCCAGTAATGG - Intronic
1077497799 11:2894926-2894948 GCCCACCCGGAAGCCCCTGAAGG - Intronic
1081756605 11:45549286-45549308 GGTCCCAGGGACGCCTGTGATGG - Intergenic
1086936147 11:92747459-92747481 GGCCTCCAGGAAGCCTGTGATGG + Intronic
1089207112 11:116773103-116773125 GGCCACCGGGACGCGCTCGCAGG + Intergenic
1089692526 11:120195734-120195756 GGCCAGAGGGACGCACGTGCGGG - Intergenic
1101053540 12:100888623-100888645 GGCCAACTGGAGGCCTGTGAGGG + Intronic
1103763722 12:123268087-123268109 GGCCACTGGGACGCCATTGCGGG - Intronic
1104655573 12:130571828-130571850 GGCCACAGGGAGGCCAGTGTGGG - Intronic
1105518114 13:21108844-21108866 GGGCACCGGGAAGCACTTGAGGG - Intergenic
1110421184 13:75310811-75310833 AGACACCGGGACCCCCTTGAGGG - Intronic
1113909265 13:113834503-113834525 GGCCCCCGGAACCACCGTGAAGG + Intronic
1114846102 14:26324010-26324032 GACCACCTGGACCCCCGAGAAGG + Intergenic
1120840122 14:89078251-89078273 GGCCTCCGGGACGCCTGCAATGG + Intergenic
1123450551 15:20357061-20357083 GTCCCACGGGAGGCCCGTGATGG + Intergenic
1128314762 15:66653618-66653640 GGCCACAGGGAGGCCACTGATGG + Intronic
1129174853 15:73832585-73832607 GGCCAGGGGGACGGCAGTGAGGG + Intergenic
1139511355 16:67430284-67430306 GGCCAGAGGGACGTCGGTGAAGG - Intergenic
1139529889 16:67537842-67537864 GGGCGCCGGGACGCCCGGGCCGG + Intronic
1142619380 17:1154999-1155021 GGCCCCCAGGGCGCCCGGGAAGG - Intronic
1143872779 17:9969584-9969606 AGCCACCTGGACTCCCATGATGG + Intronic
1144867662 17:18347271-18347293 GGCCACAGGGAAACCAGTGAGGG - Intronic
1147999824 17:44381023-44381045 GGCCACTGGGACCCCCGTAGGGG + Exonic
1148047511 17:44753206-44753228 GGCCACTTGGACGCCTGAGAGGG + Intergenic
1149651684 17:58279920-58279942 AGCCACCAGGACGGCGGTGAGGG - Exonic
1149779109 17:59382224-59382246 GGCCACCAGGACAGCCCTGAGGG + Intronic
1151678474 17:75611885-75611907 GGCCATCGGGACGCCCTGGCTGG + Intergenic
1152337886 17:79708273-79708295 GTCCTGCGGGAGGCCCGTGATGG - Intergenic
1152729299 17:81961749-81961771 GGCCACTGGGCCGCCCGCGCTGG - Intronic
1155007500 18:21741513-21741535 TGCCGCCGGGGGGCCCGTGAGGG - Exonic
1155209154 18:23586251-23586273 GGCCACCGGGACGCCCTGTGGGG - Intronic
1160842034 19:1150547-1150569 GACCACGGGGGCGTCCGTGACGG - Intronic
1160988001 19:1848410-1848432 GGCGACCGCGGCGCCAGTGAGGG - Exonic
1161072938 19:2271314-2271336 GGCCGCCCGGACGCCCTGGAGGG + Intronic
1161232226 19:3180068-3180090 GGCCACCGGGAAGACCATGGGGG - Exonic
1161302270 19:3548401-3548423 GGCCTCCAGGAAGCCCGTGCTGG + Intronic
1163597019 19:18226221-18226243 GGTCACCGGGACGCCCGGTGTGG - Intronic
1166882873 19:45939947-45939969 GGCCGCGGGGCTGCCCGTGATGG + Exonic
930728964 2:54709499-54709521 GGGCACCGATAAGCCCGTGAGGG + Intergenic
933992280 2:87642401-87642423 CCCCACCGGGACCCCTGTGAAGG - Intergenic
936301570 2:111308438-111308460 CCCCACCGGGACCCCTGTGAAGG + Intergenic
938590231 2:132728809-132728831 TGCCACCGGGACCCAGGTGAGGG - Exonic
941448909 2:165635183-165635205 GGCCCCTGGGGTGCCCGTGAGGG + Intronic
941917126 2:170820226-170820248 GGCCACCGGGAATTCCGTAAGGG - Intronic
942313984 2:174682227-174682249 GGCGAGCGGGCCGCCCGGGAGGG + Intronic
948288249 2:236803931-236803953 GGGCAATGGGATGCCCGTGAGGG - Intergenic
948559906 2:238845914-238845936 GGCCCCGGGGACGCCCTGGAAGG - Intergenic
1173790331 20:45824057-45824079 GGCCTCCGGGGAGCACGTGACGG - Exonic
1176086748 20:63298907-63298929 GGGCACCGGGGCACCCGGGACGG - Intronic
1180613831 22:17114642-17114664 GGCCAGTGGGACACCCGTGCAGG - Exonic
1184730719 22:46369657-46369679 GGGCACCCGGACTCCCGTGAAGG + Intronic
950467938 3:13166505-13166527 GGCCACCTGGAAGCCAGTAAGGG - Intergenic
955340042 3:58118153-58118175 TGCCACCCGGCCACCCGTGAGGG + Intronic
968879586 4:3292384-3292406 GGGCCCCGGGACGCCCGCGAAGG - Intergenic
982856616 4:160390411-160390433 GGCCATCGGGTTGCCAGTGATGG + Intergenic
985543397 5:497451-497473 GGGCACCGGGACTGCTGTGAAGG + Intronic
986661578 5:10064719-10064741 GGCCACCAGGAGGACCCTGAAGG - Intergenic
1004536677 6:16509868-16509890 GGCCACCCGTATGCCTGTGATGG - Intronic
1006645345 6:35511616-35511638 GGCCCCAGGGACGCGGGTGAGGG - Intronic
1007113331 6:39326357-39326379 GGCCACAGGGACGTCTGAGATGG + Intergenic
1018124176 6:160665951-160665973 GGCCACCGGGACACCCCAGGAGG + Intergenic
1019282558 7:207764-207786 GGCCTCCAGGTCGCCCGAGATGG - Intronic
1019599474 7:1874079-1874101 GGCCACCGGGGATCCCGGGACGG + Intronic
1022674078 7:32482087-32482109 GGCCACCTGGGTGCCAGTGAAGG + Intergenic
1023054881 7:36283387-36283409 GGCCATCGGGGAGCCCCTGAAGG + Intronic
1025176318 7:56804152-56804174 GGCCACCGGGAGGCCGGAGCTGG - Intergenic
1025695474 7:63772270-63772292 GGCCACCGGGAAGCCGGAGCTGG + Intergenic
1027220544 7:76211159-76211181 GGCTACCGGGACACCGGTGTGGG + Intronic
1032051746 7:128654313-128654335 GGCCACCGGGAGGCCCAAGCTGG - Intergenic
1034919910 7:155071147-155071169 GGCCACCAGGACATCCGAGACGG - Exonic
1040283772 8:46089186-46089208 GGCCACAGGCAGGCCTGTGAAGG + Intergenic
1042566472 8:70117122-70117144 GGCCACCAGGATGCACGTGAAGG + Intronic
1060389627 9:123267700-123267722 GGCCACCGGGACGCCCGTGAAGG - Intronic
1060547665 9:124470494-124470516 GGCCACGGTGAAGCCCGTGCTGG + Exonic
1061645103 9:131994796-131994818 GGCCACTGGGACTACTGTGATGG - Intronic
1062080548 9:134621210-134621232 GGGCAGCTGGACGCCCGTCAAGG + Intergenic
1062395568 9:136351303-136351325 GATCACCGGGACCCCCGGGAAGG - Intronic
1188006321 X:25017871-25017893 AGCCGCAGGGACGCCCGCGAGGG - Intergenic
1189536142 X:41937127-41937149 GGCCAACGGGAAGCCCCTGTAGG + Intergenic
1200235976 X:154467882-154467904 GGCCACCAGCACGGCTGTGATGG - Exonic