ID: 1060395170

View in Genome Browser
Species Human (GRCh38)
Location 9:123311462-123311484
Sequence TATTTACTCCCGGAGAGCGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060395162_1060395170 7 Left 1060395162 9:123311432-123311454 CCTGCTCATGGAAGGCTGTGACC No data
Right 1060395170 9:123311462-123311484 TATTTACTCCCGGAGAGCGGGGG No data
1060395161_1060395170 8 Left 1060395161 9:123311431-123311453 CCCTGCTCATGGAAGGCTGTGAC No data
Right 1060395170 9:123311462-123311484 TATTTACTCCCGGAGAGCGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060395170 Original CRISPR TATTTACTCCCGGAGAGCGG GGG Intergenic
No off target data available for this crispr