ID: 1060395728

View in Genome Browser
Species Human (GRCh38)
Location 9:123315110-123315132
Sequence CACTGCAATCCAGGAGACGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060395728_1060395733 13 Left 1060395728 9:123315110-123315132 CCTCCGTCTCCTGGATTGCAGTG No data
Right 1060395733 9:123315146-123315168 TCACCGCAACCTCCGCCTCCTGG 0: 2536
1: 45617
2: 160201
3: 141710
4: 79168
1060395728_1060395736 23 Left 1060395728 9:123315110-123315132 CCTCCGTCTCCTGGATTGCAGTG No data
Right 1060395736 9:123315156-123315178 CTCCGCCTCCTGGAGTGCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060395728 Original CRISPR CACTGCAATCCAGGAGACGG AGG (reversed) Intergenic
No off target data available for this crispr