ID: 1060398385

View in Genome Browser
Species Human (GRCh38)
Location 9:123332534-123332556
Sequence GCAGTTTACCAGCACACCAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060398385_1060398398 30 Left 1060398385 9:123332534-123332556 CCAGTGGTGTGCTGGTAAACTGC No data
Right 1060398398 9:123332587-123332609 GTAATGTTTGCCAATTTCCTTGG 0: 2
1: 5
2: 35
3: 146
4: 482
1060398385_1060398395 -4 Left 1060398385 9:123332534-123332556 CCAGTGGTGTGCTGGTAAACTGC No data
Right 1060398395 9:123332553-123332575 CTGCTGGGGGAAGGTGAGGGGGG No data
1060398385_1060398391 -8 Left 1060398385 9:123332534-123332556 CCAGTGGTGTGCTGGTAAACTGC No data
Right 1060398391 9:123332549-123332571 TAAACTGCTGGGGGAAGGTGAGG No data
1060398385_1060398392 -7 Left 1060398385 9:123332534-123332556 CCAGTGGTGTGCTGGTAAACTGC No data
Right 1060398392 9:123332550-123332572 AAACTGCTGGGGGAAGGTGAGGG No data
1060398385_1060398393 -6 Left 1060398385 9:123332534-123332556 CCAGTGGTGTGCTGGTAAACTGC No data
Right 1060398393 9:123332551-123332573 AACTGCTGGGGGAAGGTGAGGGG No data
1060398385_1060398394 -5 Left 1060398385 9:123332534-123332556 CCAGTGGTGTGCTGGTAAACTGC No data
Right 1060398394 9:123332552-123332574 ACTGCTGGGGGAAGGTGAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060398385 Original CRISPR GCAGTTTACCAGCACACCAC TGG (reversed) Intergenic
No off target data available for this crispr