ID: 1060400883

View in Genome Browser
Species Human (GRCh38)
Location 9:123349025-123349047
Sequence AGACCTCTAACTCCCAGCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060400883_1060400889 25 Left 1060400883 9:123349025-123349047 CCTGGGCTGGGAGTTAGAGGTCT No data
Right 1060400889 9:123349073-123349095 GTTCTCTGGGTGACCCCAGAAGG No data
1060400883_1060400887 12 Left 1060400883 9:123349025-123349047 CCTGGGCTGGGAGTTAGAGGTCT No data
Right 1060400887 9:123349060-123349082 TAGCTCTGCCACGGTTCTCTGGG No data
1060400883_1060400886 11 Left 1060400883 9:123349025-123349047 CCTGGGCTGGGAGTTAGAGGTCT No data
Right 1060400886 9:123349059-123349081 TTAGCTCTGCCACGGTTCTCTGG No data
1060400883_1060400884 3 Left 1060400883 9:123349025-123349047 CCTGGGCTGGGAGTTAGAGGTCT No data
Right 1060400884 9:123349051-123349073 TTTGAGCCTTAGCTCTGCCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060400883 Original CRISPR AGACCTCTAACTCCCAGCCC AGG (reversed) Intergenic
No off target data available for this crispr