ID: 1060400886

View in Genome Browser
Species Human (GRCh38)
Location 9:123349059-123349081
Sequence TTAGCTCTGCCACGGTTCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060400883_1060400886 11 Left 1060400883 9:123349025-123349047 CCTGGGCTGGGAGTTAGAGGTCT No data
Right 1060400886 9:123349059-123349081 TTAGCTCTGCCACGGTTCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060400886 Original CRISPR TTAGCTCTGCCACGGTTCTC TGG Intergenic
No off target data available for this crispr