ID: 1060401626

View in Genome Browser
Species Human (GRCh38)
Location 9:123353080-123353102
Sequence CAGAGGGAGCAGGGGGACCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060401619_1060401626 -9 Left 1060401619 9:123353066-123353088 CCCAGACTCAGACACAGAGGGAG No data
Right 1060401626 9:123353080-123353102 CAGAGGGAGCAGGGGGACCTGGG No data
1060401612_1060401626 18 Left 1060401612 9:123353039-123353061 CCCAGTGAGGTCAGGGCTGATGG No data
Right 1060401626 9:123353080-123353102 CAGAGGGAGCAGGGGGACCTGGG No data
1060401620_1060401626 -10 Left 1060401620 9:123353067-123353089 CCAGACTCAGACACAGAGGGAGC No data
Right 1060401626 9:123353080-123353102 CAGAGGGAGCAGGGGGACCTGGG No data
1060401614_1060401626 17 Left 1060401614 9:123353040-123353062 CCAGTGAGGTCAGGGCTGATGGT No data
Right 1060401626 9:123353080-123353102 CAGAGGGAGCAGGGGGACCTGGG No data
1060401609_1060401626 29 Left 1060401609 9:123353028-123353050 CCTTAGAGAAACCCAGTGAGGTC No data
Right 1060401626 9:123353080-123353102 CAGAGGGAGCAGGGGGACCTGGG No data
1060401618_1060401626 -8 Left 1060401618 9:123353065-123353087 CCCCAGACTCAGACACAGAGGGA No data
Right 1060401626 9:123353080-123353102 CAGAGGGAGCAGGGGGACCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060401626 Original CRISPR CAGAGGGAGCAGGGGGACCT GGG Intergenic
No off target data available for this crispr