ID: 1060401871

View in Genome Browser
Species Human (GRCh38)
Location 9:123354200-123354222
Sequence AAGTGTCTTGTGAGGTCTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060401871_1060401879 5 Left 1060401871 9:123354200-123354222 CCTCCAGACCTCACAAGACACTT No data
Right 1060401879 9:123354228-123354250 TCTGGCCACAAGGTGGAGTGTGG No data
1060401871_1060401883 25 Left 1060401871 9:123354200-123354222 CCTCCAGACCTCACAAGACACTT No data
Right 1060401883 9:123354248-123354270 TGGCGGCTGCAGGACAGTGCTGG No data
1060401871_1060401884 26 Left 1060401871 9:123354200-123354222 CCTCCAGACCTCACAAGACACTT No data
Right 1060401884 9:123354249-123354271 GGCGGCTGCAGGACAGTGCTGGG No data
1060401871_1060401880 8 Left 1060401871 9:123354200-123354222 CCTCCAGACCTCACAAGACACTT No data
Right 1060401880 9:123354231-123354253 GGCCACAAGGTGGAGTGTGGCGG No data
1060401871_1060401877 -2 Left 1060401871 9:123354200-123354222 CCTCCAGACCTCACAAGACACTT No data
Right 1060401877 9:123354221-123354243 TTCCAGGTCTGGCCACAAGGTGG No data
1060401871_1060401882 15 Left 1060401871 9:123354200-123354222 CCTCCAGACCTCACAAGACACTT No data
Right 1060401882 9:123354238-123354260 AGGTGGAGTGTGGCGGCTGCAGG No data
1060401871_1060401876 -5 Left 1060401871 9:123354200-123354222 CCTCCAGACCTCACAAGACACTT No data
Right 1060401876 9:123354218-123354240 CACTTCCAGGTCTGGCCACAAGG No data
1060401871_1060401886 28 Left 1060401871 9:123354200-123354222 CCTCCAGACCTCACAAGACACTT No data
Right 1060401886 9:123354251-123354273 CGGCTGCAGGACAGTGCTGGGGG No data
1060401871_1060401885 27 Left 1060401871 9:123354200-123354222 CCTCCAGACCTCACAAGACACTT No data
Right 1060401885 9:123354250-123354272 GCGGCTGCAGGACAGTGCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060401871 Original CRISPR AAGTGTCTTGTGAGGTCTGG AGG (reversed) Intergenic
No off target data available for this crispr