ID: 1060402007

View in Genome Browser
Species Human (GRCh38)
Location 9:123354806-123354828
Sequence GGTCCCCAGGGACCAAAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060402007_1060402018 1 Left 1060402007 9:123354806-123354828 CCCTCCTTTGGTCCCTGGGGACC No data
Right 1060402018 9:123354830-123354852 AGGGCTGTGGCACTTGCCCCGGG No data
1060402007_1060402019 8 Left 1060402007 9:123354806-123354828 CCCTCCTTTGGTCCCTGGGGACC No data
Right 1060402019 9:123354837-123354859 TGGCACTTGCCCCGGGCTAGAGG No data
1060402007_1060402017 0 Left 1060402007 9:123354806-123354828 CCCTCCTTTGGTCCCTGGGGACC No data
Right 1060402017 9:123354829-123354851 CAGGGCTGTGGCACTTGCCCCGG No data
1060402007_1060402024 18 Left 1060402007 9:123354806-123354828 CCCTCCTTTGGTCCCTGGGGACC No data
Right 1060402024 9:123354847-123354869 CCCGGGCTAGAGGGTCGGCCAGG No data
1060402007_1060402020 9 Left 1060402007 9:123354806-123354828 CCCTCCTTTGGTCCCTGGGGACC No data
Right 1060402020 9:123354838-123354860 GGCACTTGCCCCGGGCTAGAGGG No data
1060402007_1060402026 19 Left 1060402007 9:123354806-123354828 CCCTCCTTTGGTCCCTGGGGACC No data
Right 1060402026 9:123354848-123354870 CCGGGCTAGAGGGTCGGCCAGGG No data
1060402007_1060402021 13 Left 1060402007 9:123354806-123354828 CCCTCCTTTGGTCCCTGGGGACC No data
Right 1060402021 9:123354842-123354864 CTTGCCCCGGGCTAGAGGGTCGG No data
1060402007_1060402027 28 Left 1060402007 9:123354806-123354828 CCCTCCTTTGGTCCCTGGGGACC No data
Right 1060402027 9:123354857-123354879 AGGGTCGGCCAGGGCCTGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060402007 Original CRISPR GGTCCCCAGGGACCAAAGGA GGG (reversed) Intergenic
No off target data available for this crispr