ID: 1060404139

View in Genome Browser
Species Human (GRCh38)
Location 9:123364777-123364799
Sequence CAGGGTGATGGTGAAGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1094
Summary {0: 1, 1: 1, 2: 8, 3: 118, 4: 966}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060404139_1060404154 28 Left 1060404139 9:123364777-123364799 CCTTCCTCTTCACCATCACCCTG 0: 1
1: 1
2: 8
3: 118
4: 966
Right 1060404154 9:123364828-123364850 CCAGGACTGCGAGGGTTCTGGGG No data
1060404139_1060404150 26 Left 1060404139 9:123364777-123364799 CCTTCCTCTTCACCATCACCCTG 0: 1
1: 1
2: 8
3: 118
4: 966
Right 1060404150 9:123364826-123364848 GCCCAGGACTGCGAGGGTTCTGG No data
1060404139_1060404149 20 Left 1060404139 9:123364777-123364799 CCTTCCTCTTCACCATCACCCTG 0: 1
1: 1
2: 8
3: 118
4: 966
Right 1060404149 9:123364820-123364842 TGATTCGCCCAGGACTGCGAGGG No data
1060404139_1060404148 19 Left 1060404139 9:123364777-123364799 CCTTCCTCTTCACCATCACCCTG 0: 1
1: 1
2: 8
3: 118
4: 966
Right 1060404148 9:123364819-123364841 GTGATTCGCCCAGGACTGCGAGG No data
1060404139_1060404147 10 Left 1060404139 9:123364777-123364799 CCTTCCTCTTCACCATCACCCTG 0: 1
1: 1
2: 8
3: 118
4: 966
Right 1060404147 9:123364810-123364832 TCAGCTGTCGTGATTCGCCCAGG No data
1060404139_1060404152 27 Left 1060404139 9:123364777-123364799 CCTTCCTCTTCACCATCACCCTG 0: 1
1: 1
2: 8
3: 118
4: 966
Right 1060404152 9:123364827-123364849 CCCAGGACTGCGAGGGTTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060404139 Original CRISPR CAGGGTGATGGTGAAGAGGA AGG (reversed) Intronic
900019711 1:180498-180520 GAGGGTGAGGGTGAGGATGAGGG - Intergenic
900475199 1:2873199-2873221 CAGGGAGTTGGGGAGGAGGAAGG - Intergenic
900505116 1:3026276-3026298 GATGGTGATGGTGATGATGATGG + Intergenic
900650315 1:3727191-3727213 CAGGGTGATGATGATGAGGATGG - Exonic
900769152 1:4527144-4527166 CAGGGTGAATGTCTAGAGGAGGG - Intergenic
900802881 1:4748197-4748219 CAGGGTGAGGGTCAATGGGAGGG - Intronic
900805814 1:4767676-4767698 GATGGTGATGGTGATGATGATGG - Intronic
901020844 1:6254621-6254643 CAGGGTGAGGGTGTAGAAGGTGG + Exonic
901275817 1:7990219-7990241 GAGGGTGATGGTGATGACGGTGG - Intergenic
901565072 1:10107307-10107329 GATGGTGATGGTGATGATGAAGG + Intronic
901794409 1:11672158-11672180 CAGGGTGTGGGTGCAGAGCAGGG - Intronic
901863321 1:12088558-12088580 CAGGAAGATGGAGAACAGGAAGG - Intronic
901873497 1:12152466-12152488 CAGGGTGAAGGGGAAAAGCAAGG + Intergenic
902372685 1:16015987-16016009 CAGGGACATGGGGAAGAGGTGGG + Intronic
903121058 1:21217481-21217503 CAGGGGGTTGGGGAAGAAGAGGG - Intronic
903287337 1:22285391-22285413 CCGGATGCTGATGAAGAGGAAGG + Intergenic
903416786 1:23189040-23189062 CAGCGTGATGGTGACGATGCAGG - Intergenic
903420359 1:23214635-23214657 CAGGGTGATGTGGTGGAGGAGGG - Intergenic
903476924 1:23625979-23626001 GATGGTGATGGTGATGATGATGG + Intronic
903476940 1:23626084-23626106 GATGGTGATGGTGATGATGATGG + Intronic
904324455 1:29719034-29719056 GAAGGTGATGGTGATGATGATGG - Intergenic
904413342 1:30338836-30338858 GATGGTGATGGTGATGATGATGG + Intergenic
904413354 1:30339019-30339041 AATGGTGATGGTGATGATGATGG + Intergenic
904431018 1:30464231-30464253 GATGGTGATGGTGAAGATGATGG + Intergenic
904471971 1:30741664-30741686 CAGGCTGATGATGAAGAGCATGG + Exonic
904565471 1:31425803-31425825 CTGGATGAGGATGAAGAGGAAGG - Exonic
904772594 1:32888680-32888702 CAGGGAGATGGTGTGGAGCATGG + Intronic
904884124 1:33723694-33723716 AAGGGTGAATGTGAAGAAGAGGG + Intronic
906515281 1:46435467-46435489 CAGGGTCATGGTCAGGACGAAGG - Intergenic
906694071 1:47812265-47812287 CAAGGTGATGGAGGAGATGACGG + Intronic
906950952 1:50333970-50333992 CAGGGTCGTGGTTAAGAGCATGG + Intergenic
907320158 1:53596931-53596953 CTGGGTGATGCTGAAGAAGTGGG + Intronic
907327309 1:53647269-53647291 CAGGGTGATCCTGAAGAATAAGG + Intronic
907449742 1:54537489-54537511 CAGGGTGGTGGTGGATATGATGG + Intergenic
907507035 1:54926859-54926881 GAGGCTGATGGTGATGAGGATGG - Intergenic
907724717 1:57008439-57008461 GATGGTGATGGTGATGATGAGGG + Intronic
907850049 1:58247764-58247786 GAGGGTGGTGGTGAGGAGAAGGG - Intronic
908634025 1:66142170-66142192 CAGGTTGAGGAGGAAGAGGAAGG + Intronic
908692583 1:66799439-66799461 GAGGGTGAGGGTGAGGGGGATGG + Intronic
909492645 1:76242596-76242618 CAGGGTGAGGGGAAAGGGGAGGG - Intronic
909535266 1:76728633-76728655 GAGGGAGATGCTGAGGAGGAGGG - Intergenic
909563998 1:77034696-77034718 CAGGCAGGTGGTGCAGAGGAAGG + Intronic
909822675 1:80086017-80086039 CAAGGTCTTGGTGATGAGGATGG + Intergenic
910206239 1:84751602-84751624 CAGGGTGGTGGTGGGGAGGAGGG - Intergenic
910429120 1:87143700-87143722 CAGGATGATGATGACGATGATGG + Intronic
910587440 1:88895007-88895029 CATGGTGATGTTGGAGAAGATGG + Intergenic
910769513 1:90816946-90816968 CAGGGTGGTGGTGGAGGAGATGG - Intergenic
910847441 1:91617033-91617055 CAGGTTGAAGGTGAATAGTACGG + Intergenic
911415249 1:97563805-97563827 AAGGGTGGAGGTGATGAGGATGG - Intronic
911940377 1:104038819-104038841 CAGGGAGAATGTGAAGATGAAGG - Intergenic
912179972 1:107208021-107208043 CACGATCATGATGAAGAGGAGGG - Intronic
912561953 1:110557333-110557355 TAAGGTGATGGTGATGATGATGG + Intergenic
912719190 1:112005425-112005447 CAGGAAGAAGGTGCAGAGGAGGG + Intergenic
913380091 1:118201183-118201205 AAGGGTAATGGAGAAGAGGGAGG - Intergenic
913669533 1:121083022-121083044 CAGAGTCATGGTGACAAGGACGG - Intergenic
914843934 1:151270135-151270157 CAGGGTGAAGGTGCAGGGAAGGG - Intergenic
914901420 1:151713223-151713245 CAGGGTGGGGGTGAGGAAGAAGG - Intronic
915053846 1:153106824-153106846 CAGGGTGATGGTTATGGGGAAGG + Intergenic
915754922 1:158250197-158250219 CAGGGTAGTGGTGGACAGGAGGG + Intergenic
915826861 1:159087284-159087306 CAGGGTGATGGTAAGGATGATGG + Intronic
916217697 1:162411625-162411647 CATGGTGGTGGTGAAGGGAAGGG - Intronic
916332085 1:163628360-163628382 AGGGGGGATGGGGAAGAGGATGG - Intergenic
916965604 1:169939310-169939332 GAGGGTAATGGTGAAGAAAAGGG + Intronic
917452885 1:175161862-175161884 AAGGGTAATGAGGAAGAGGAAGG - Intronic
918380996 1:183955104-183955126 TAGGATAATGGTTAAGAGGAAGG + Intronic
918444360 1:184602121-184602143 CAGGGTGAGGGTGAGGATGGTGG - Intronic
919409180 1:197222437-197222459 CATGGTGATGGTGAAGGGAGTGG + Intergenic
919847202 1:201649533-201649555 CAGCCTGATCGTGAACAGGAGGG - Intronic
920070922 1:203302627-203302649 CTGGGTAATGGTGGAGACGAGGG + Intergenic
920844270 1:209580489-209580511 CAGGGTGCAGGTGAATTGGAGGG + Intergenic
921048604 1:211494792-211494814 CAAGGTGATGGTTAGGAGGTGGG + Intergenic
921165185 1:212502011-212502033 CAGGGAGATGGTGGGGAGGTGGG + Intergenic
921269542 1:213455123-213455145 CAGAGTGATAGAGAAAAGGATGG + Intergenic
921276311 1:213524272-213524294 CTGGGTGATGGTGAGGAGCAGGG - Intergenic
921509058 1:216008969-216008991 AAGGGTGAAGGAGAAGAGGTTGG - Intronic
922252810 1:223864989-223865011 CAGGGTGGGGGTGAAGGAGAGGG - Intergenic
922579420 1:226685966-226685988 AAGAGTGAGGGAGAAGAGGAGGG + Intronic
922804676 1:228379105-228379127 CAGCGTGATGGAAGAGAGGAAGG - Intergenic
922806920 1:228395013-228395035 CAGGGAGAACGTGAACAGGAAGG - Exonic
922846326 1:228687915-228687937 GAGGGAGATGGAGCAGAGGAGGG - Intergenic
922982538 1:229839847-229839869 CAGGGAGCTGTTGAAGGGGAAGG + Intergenic
923048136 1:230370257-230370279 CATGGGGAATGTGAAGAGGATGG - Intronic
923109492 1:230879699-230879721 CAGGGTGATTGTGGAGGGGGAGG - Intergenic
923109505 1:230879737-230879759 CAGGGTGATTGAGGAGGGGAAGG - Intergenic
923109542 1:230879849-230879871 CAGGGTGATTGTGGAGGGGGAGG - Intergenic
923317645 1:232796752-232796774 AAGGGGGATTGTGAAGATGAAGG - Intergenic
923547986 1:234938641-234938663 CAGGGTGAGAGGGAAGAGAACGG + Intergenic
923766754 1:236899301-236899323 CAGTGTCATGGTGCAGAGGTAGG + Exonic
923958790 1:239053694-239053716 ACAGGTGATGGTGAATAGGAAGG - Intergenic
924217982 1:241845094-241845116 CAGTGTAAAGGTGAAGATGAAGG - Intergenic
924413165 1:243828398-243828420 GAGTGTAATGGTTAAGAGGATGG - Intronic
924593272 1:245423273-245423295 CAGGGTTACTGTGAAGATGAAGG - Intronic
924607810 1:245550448-245550470 CAGGGTGCTGGTGAGGAGCCAGG - Intronic
1062912345 10:1219729-1219751 GATGGTGATGGTGAAGATAATGG + Intronic
1062912360 10:1219842-1219864 GATGGTGATGGTGATGATGATGG + Intronic
1062946252 10:1464372-1464394 CAGCGTGCTGGAGAAGAGGGTGG + Intronic
1062946338 10:1464768-1464790 CAGCGTGCTGGAGAAGAGGGTGG + Intronic
1062971789 10:1654095-1654117 CAGGGTGATGGGGAAGGAGCAGG - Intronic
1063206984 10:3841991-3842013 CACAGTGATGGTGATGATGATGG - Intergenic
1063765985 10:9141066-9141088 CAGAGGGAAGGTGAAGTGGATGG + Intergenic
1063840021 10:10060808-10060830 CAGGGTTATGGGGGAGAAGAGGG + Intergenic
1064267265 10:13835122-13835144 AAGTGTAATGGTTAAGAGGAGGG + Intronic
1065115600 10:22479871-22479893 CATGGTGATGGTGATGGTGATGG - Intergenic
1066000819 10:31102804-31102826 CAGGGTGATGGAGACCAGGAGGG + Intergenic
1068083028 10:52343433-52343455 CAGGATGATGATGATGATGATGG + Intergenic
1068365574 10:56045116-56045138 GAGGAGGATGGGGAAGAGGAGGG - Intergenic
1069751571 10:70748518-70748540 CAGGGTGAGGGTGGGGAAGAGGG - Intronic
1069833865 10:71296618-71296640 CAGGGTGAAAGTGCAGTGGAGGG - Exonic
1069852683 10:71420394-71420416 GATGGTGATGGTGATGATGATGG + Intronic
1070056460 10:72939760-72939782 CAAGATAATGGTGGAGAGGAAGG + Intronic
1070121198 10:73579050-73579072 GAGGGTGATGGGGCTGAGGAAGG - Intronic
1070442682 10:76462454-76462476 CTGGGTGAAGAGGAAGAGGATGG - Intronic
1070650297 10:78230526-78230548 GAGGGTGATGGTGGTGAAGATGG - Intergenic
1070788932 10:79178397-79178419 AGGGGTGATGGTGGAGAGAATGG - Intronic
1070824235 10:79381554-79381576 CACGGTGATGGGGAGGAGGCAGG - Intergenic
1070830843 10:79417315-79417337 TGGGGTGATGGTGAGGTGGAGGG - Intronic
1072251797 10:93587476-93587498 CAGTGTCATGTTGTAGAGGATGG - Exonic
1072548368 10:96457729-96457751 ATGGCTGAGGGTGAAGAGGAAGG + Intronic
1072636227 10:97180144-97180166 CTGCCTGATGGCGAAGAGGAGGG + Intronic
1072745646 10:97937372-97937394 CAGGGTGGTGGTGCAGTGGCGGG - Intronic
1072978076 10:100076402-100076424 CAGGGTGAGGGTAATAAGGATGG + Intronic
1072985236 10:100133907-100133929 CAGGGGGATGGAGAGGAGGAAGG - Intergenic
1073101183 10:101007506-101007528 CGGGGGGAATGTGAAGAGGAGGG - Exonic
1073146382 10:101284510-101284532 CAGGATGAGGGTGTCGAGGAGGG + Intergenic
1073146657 10:101285814-101285836 GAGGGGGGTGGTGAAGAGGCGGG - Intergenic
1073215628 10:101834507-101834529 CGGGGTGATGGGGGAGAGGAAGG - Intronic
1073310271 10:102535162-102535184 CAGGAGGAAGGGGAAGAGGAAGG + Intronic
1073637803 10:105217340-105217362 CAGAGTGGTGCTGAAAAGGACGG - Intronic
1074460288 10:113630444-113630466 CATGGTGATGGTGAAGGTGATGG + Intronic
1074503226 10:114044410-114044432 CAGGGACATGATGAAGAGGTTGG - Exonic
1074616580 10:115075004-115075026 CAGTGTGGTGGTGAAGAGTGTGG - Intergenic
1074885800 10:117692326-117692348 GAGGGTGATGGATAGGAGGAGGG - Intergenic
1075584234 10:123645571-123645593 CAGGGTGGTGGTGGTGATGATGG + Intergenic
1075622144 10:123935746-123935768 GATGGTGATGGTGATGATGATGG - Intronic
1075780812 10:125016067-125016089 CGGGGTGACGGGGAAGGGGATGG + Intronic
1076065577 10:127445199-127445221 CAGGGAGAAGGTGCTGAGGATGG + Intronic
1076206551 10:128609006-128609028 GGGTGTGAAGGTGAAGAGGATGG - Intergenic
1076365400 10:129918550-129918572 CAGGTTGGTGGTGCGGAGGAGGG - Intronic
1076615202 10:131750303-131750325 CAGGGGGCTGGGGAAGAGGGCGG + Intergenic
1076691794 10:132227435-132227457 GACGGTGATGGTGAGGATGACGG + Intronic
1076963701 10:133787280-133787302 CAGGGTGAGGGTGAGGGTGAGGG + Intergenic
1076963711 10:133787310-133787332 CAGGGTGAGGGTGAGGGTGAGGG + Intergenic
1076976481 11:176220-176242 GAGGGTGAGGGTGAGGATGAAGG - Intronic
1077227038 11:1443026-1443048 CAGGGTGATGGTGCACCGCAGGG - Intronic
1077460068 11:2704633-2704655 CAGGGTGAGGGGGAAGACTACGG + Intronic
1077614621 11:3666143-3666165 CAGGGCCATGGAGAAGAAGATGG + Exonic
1077917575 11:6621494-6621516 CAGGGTGCTGGTGCAGGGCAGGG + Exonic
1078019182 11:7641125-7641147 CTGAGTGCTGGTGAAGGGGAGGG - Intronic
1079006264 11:16793460-16793482 CAGGTAGATGGTGAAGACCAGGG + Intronic
1079293157 11:19206962-19206984 AAGGGTGATGGATAAGAAGATGG - Intronic
1079356511 11:19734509-19734531 CAGATTGAGGGTGAATAGGAAGG - Intronic
1079712513 11:23703989-23704011 CAGGCTGATGGTGAAGCAAATGG - Intergenic
1080115963 11:28621864-28621886 TTGGGTGATGGGGAGGAGGAAGG - Intergenic
1080133537 11:28825716-28825738 CAGGTTGGCAGTGAAGAGGAAGG - Intergenic
1081096936 11:38947969-38947991 CAGGGTGGAGGTTGAGAGGAGGG + Intergenic
1081460002 11:43263791-43263813 CAGGGAGAAGCTGAGGAGGATGG - Intergenic
1081735947 11:45404372-45404394 CAGGAGGATGGTGATGGGGAAGG - Intergenic
1081753385 11:45527924-45527946 CAGGGTGATGGTGAGGGGTTGGG - Intergenic
1081805867 11:45890217-45890239 CTGGCTGTTGGTGAAGAGGTCGG - Intronic
1081919098 11:46756220-46756242 GATGATAATGGTGAAGAGGAAGG - Intronic
1082234090 11:49801441-49801463 TAGGCTGATGGGGAAGAGGAAGG - Intergenic
1082834419 11:57641021-57641043 CAGGGGGTTGGTGAAGAAGGCGG + Intergenic
1083150864 11:60790975-60790997 CAGAGCGATGGTGATGTGGAAGG - Exonic
1083170907 11:60923739-60923761 CAGGTGGGTGGTGAAGGGGAGGG - Intergenic
1083199394 11:61110887-61110909 GACGGTGATGGTGATGATGATGG + Intronic
1083268308 11:61557505-61557527 CAGGGTGCTGGAGTGGAGGAGGG - Intronic
1083860544 11:65417912-65417934 CAGTGAGCTGGTGAAGAGGCAGG + Intergenic
1083974486 11:66106632-66106654 CTGGGTGGAGGTGAAGAGGTAGG + Intronic
1084093335 11:66893855-66893877 CAGGGAGAGGGTGGTGAGGAAGG - Intronic
1084142395 11:67241270-67241292 CAGCGTGGGGGTGAAGAGGCGGG - Intronic
1084295436 11:68210753-68210775 CAGGGTGATGGAGCGGAGGGAGG + Intronic
1084355342 11:68634682-68634704 CAGGGTGAAGGAGAAGGGGTTGG - Intergenic
1084686944 11:70701881-70701903 GAGGGTGGTGGTGATGATGATGG - Intronic
1084687014 11:70702397-70702419 GATGATGATGGTGAAGAGGATGG - Intronic
1084705586 11:70814425-70814447 CAGGATGATGGGGCACAGGAGGG + Intronic
1084730303 11:71068919-71068941 CATGGTGATGGTGATGATGGTGG - Intronic
1084730321 11:71069034-71069056 CATGGTGATGGTGATGATGGTGG - Intronic
1084730334 11:71069113-71069135 CATGGTGATGGTGATGATGGTGG - Intronic
1084778505 11:71393435-71393457 GATGGTGATGGTGATGATGATGG - Intergenic
1084863575 11:72038631-72038653 CAGGGGGAGGGTGGGGAGGATGG - Intronic
1085035492 11:73297411-73297433 CTGGGTGAAGTAGAAGAGGATGG - Exonic
1085263902 11:75224987-75225009 CTGGGTGGTGGTGAGGAGGTGGG - Intergenic
1086426058 11:86683323-86683345 CAGGATGAGGGGAAAGAGGAAGG + Intergenic
1086582381 11:88414163-88414185 CAGGGTGGTGGTGGGGAGGATGG - Intergenic
1086617501 11:88840003-88840025 TAGGCTGATGGGGAAGAGGAAGG + Intronic
1086862691 11:91943821-91943843 CAGGGTAATGGTGGTGAAGATGG - Intergenic
1086931332 11:92696264-92696286 CAGTGTGGAGGTGGAGAGGAGGG + Intronic
1087105127 11:94400909-94400931 CAGGTTGACGATGAAGAGGCTGG + Exonic
1087904124 11:103675753-103675775 CAGGGTGAGGGACAAGGGGAGGG + Intergenic
1088143498 11:106647601-106647623 CAGCATGATGGTGAGGAAGATGG - Intergenic
1088339326 11:108745116-108745138 AAGGGAGAAGGGGAAGAGGAAGG - Intronic
1088562274 11:111127340-111127362 CAGGAAGATTGTGAAAAGGATGG - Intergenic
1088603566 11:111507136-111507158 CAGAGTGATGTTTAAGAGGATGG + Intronic
1089412806 11:118260966-118260988 AAGGAGGATGGGGAAGAGGATGG + Intronic
1089672972 11:120069260-120069282 AAGGGTGAAGGGGAAGAGGAGGG - Intergenic
1090921538 11:131210479-131210501 AAGGGTAATGGTGATGGGGAGGG + Intergenic
1092192125 12:6528748-6528770 CATGGTGAAGGTGAAGGGGCAGG + Exonic
1092196784 12:6554644-6554666 TAGGGTGAGGGTGGAGAGCAGGG - Intronic
1092835886 12:12487883-12487905 GAGGGTCATGGGGAAGAGAAAGG - Intronic
1093025341 12:14240488-14240510 AAGGGTGGCGGTGAAGGGGAGGG + Intergenic
1093626199 12:21351078-21351100 CAGTGTGATGGTTAAGAGCCAGG - Intronic
1093982755 12:25493002-25493024 CAGGCTAATGGAGAAAAGGAAGG - Intronic
1094075886 12:26473851-26473873 CAGGATGATGGACAAGTGGAAGG - Intronic
1094108310 12:26835730-26835752 TAGGGACAGGGTGAAGAGGAAGG - Intergenic
1094404401 12:30099706-30099728 CAGGGTTATGGTTAAGAACACGG - Intergenic
1094822389 12:34236465-34236487 CATGGTGATGATGATGATGATGG - Intergenic
1095092349 12:38119031-38119053 GACGGTGATGGTGATGATGATGG + Intergenic
1095399388 12:41796732-41796754 GAAGGTGATGGTTTAGAGGAGGG + Intergenic
1095762063 12:45851031-45851053 ACAGGTGATGGTGAAGAAGATGG - Exonic
1096039827 12:48504614-48504636 CAGAATGATGTTGAAAAGGAGGG - Intergenic
1096469886 12:51869320-51869342 CAGGCTGTGGGGGAAGAGGAGGG + Intergenic
1096694491 12:53339805-53339827 GAGGGTGATGGTGTGGACGATGG - Intronic
1096695381 12:53345232-53345254 TGGGGTGATGGGGAAGAGAAAGG - Intronic
1097152212 12:56987383-56987405 CAGGGTGTTGATGGACAGGAGGG + Intergenic
1097279186 12:57834069-57834091 CAGGGTAATGGTTAAGAGCCTGG - Intronic
1097696458 12:62779726-62779748 CAGGATGGTGGTTAAGAGCAGGG - Intronic
1097818132 12:64098226-64098248 CAAGGTGATGGGGATGGGGAAGG - Intronic
1098101875 12:67026608-67026630 CAGGATAATGAAGAAGAGGAAGG - Intergenic
1099241026 12:80139131-80139153 CAGATTGCTGGTGAGGAGGATGG + Intergenic
1099420336 12:82450420-82450442 CAGAGTGATGGTCCTGAGGACGG - Intronic
1100185673 12:92136443-92136465 AAGAGTAATGGTGAACAGGAGGG - Intronic
1100322596 12:93509880-93509902 CTGGGGGATGGTGATGAGGGAGG - Exonic
1101018030 12:100522180-100522202 GATGGTGATGGTGATGATGATGG + Intronic
1101243849 12:102865806-102865828 CAGGGAGATGGAGAAGATGATGG - Intronic
1101695582 12:107122645-107122667 CAGAGTCAAGGTGAAGATGATGG + Intergenic
1101744578 12:107529169-107529191 GATGGTGATGGTGATGATGATGG + Intronic
1101744588 12:107529271-107529293 GATGGTGATGGTGATGATGATGG + Intronic
1101800109 12:108014300-108014322 TCGGGGGATGGTGAACAGGATGG + Intergenic
1101872527 12:108577697-108577719 GATGGTGATGGTGATGATGATGG - Intergenic
1102072727 12:110035137-110035159 CAGGCTGATGGTGATGTGCAGGG - Intronic
1102353929 12:112216438-112216460 CAGGGAAGTGGTGAAGTGGAGGG + Intronic
1102391050 12:112548868-112548890 GATGGTGATGGTGTAGGGGATGG + Intergenic
1102989493 12:117304636-117304658 CAAGGGGGTGGTGAAGATGAGGG + Intronic
1102996107 12:117351852-117351874 CTGGATGATGGAGAAGAGGCAGG - Intronic
1103248653 12:119480731-119480753 GAGGATGATGGTGATGATGATGG - Intronic
1103561353 12:121794703-121794725 CAGGGTGAGGAGTAAGAGGAGGG - Intronic
1103871110 12:124092685-124092707 GATGGTGATGGTGATGATGATGG + Intronic
1103871112 12:124092703-124092725 GATGGTGATGGTGATGATGATGG + Intronic
1103871118 12:124092765-124092787 GATGGTGATGGTGATGATGATGG + Intronic
1103871201 12:124093514-124093536 GATGGTGATGGTGATGATGATGG + Intronic
1103871209 12:124093565-124093587 GATGGTGATGGTGATGATGATGG + Intronic
1104050433 12:125190622-125190644 GATGGTGATGGTGATGGGGAAGG + Intronic
1104050554 12:125190973-125190995 GATGGTGATGGTGATGGGGAAGG + Intronic
1104050639 12:125191235-125191257 GATGGTGATGGTGATGGGGAAGG + Intronic
1104256755 12:127146234-127146256 CAGGACGATGACGAAGAGGACGG + Intergenic
1104329625 12:127832388-127832410 TACGGTGATGGTGATGATGAAGG - Intergenic
1104663142 12:130626861-130626883 CGTGGTGATGGAGAAGATGATGG - Intronic
1104663158 12:130626975-130626997 CATGGTGATGGAGAAGATGATGG - Intronic
1104683204 12:130766681-130766703 GATGGTGATGGTGATGACGATGG - Intergenic
1104743982 12:131199187-131199209 GATGGTGATGGTGAGGATGATGG - Intergenic
1104744002 12:131199332-131199354 GATGGTGATGGTGAGGATGATGG - Intergenic
1104744006 12:131199359-131199381 GACGGTGATGGTGATGATGATGG - Intergenic
1104744011 12:131199398-131199420 GATGGTGATGGTGAGGATGATGG - Intergenic
1104762182 12:131303992-131304014 GATGGTGATGGTGATGATGATGG - Intergenic
1104762192 12:131304135-131304157 AATGGTGATGGTGATGATGATGG - Intergenic
1104777006 12:131395814-131395836 GATGGTGATGGTGATGATGATGG + Intergenic
1104777420 12:131399046-131399068 AATGGTGATGGTGATGATGATGG + Intergenic
1104798848 12:131539434-131539456 GATGGTGATGGTGATGATGATGG + Intergenic
1104817584 12:131656661-131656683 AATGGTGATGGTGATGATGATGG + Intergenic
1104817594 12:131656804-131656826 GATGGTGATGGTGATGATGATGG + Intergenic
1104955597 12:132464268-132464290 GATGGTGATGGTGATGATGATGG - Intergenic
1104974144 12:132544669-132544691 CATGGTGGTGGTAATGAGGATGG + Intronic
1104974175 12:132544854-132544876 GAGGGTGATGGTGATGAGGATGG + Intronic
1105009035 12:132742756-132742778 GAGGATGATGGTGGTGAGGATGG - Intronic
1105032025 12:132890594-132890616 CAGGCTAATGGAGAAGAGGGAGG - Intronic
1105072200 12:133241382-133241404 TAGGGTGAAGGTGAGGATGAGGG + Intergenic
1105282914 13:18979585-18979607 GAGGCTGAGGGAGAAGAGGAGGG - Intergenic
1105329991 13:19406976-19406998 TAGCGTGATGGTGAAGAGCTGGG - Intergenic
1105596999 13:21848236-21848258 CAAGGTGATTGTGAACGGGAAGG - Intergenic
1105619791 13:22055777-22055799 CAGGGTGGTGGACAAGAGGGTGG + Intergenic
1105751500 13:23425543-23425565 CATGGTGGTGGGGAAGAGGTGGG + Intronic
1106017408 13:25882952-25882974 GATGGTGATGGTGATGATGATGG + Intronic
1106068899 13:26387561-26387583 CAGGGTGATGATAGAGAGTAGGG + Intronic
1106319210 13:28622819-28622841 GAGGGTGTAGGTGAAGAGGGAGG - Intergenic
1106404556 13:29462509-29462531 CAGGGTGGTGGTGGTGAGGAGGG + Intronic
1106500697 13:30325633-30325655 CAGGGAGATGGTAGAGAGAAAGG + Intergenic
1107177741 13:37419412-37419434 GAGTGTGATGATTAAGAGGAGGG + Intergenic
1107677034 13:42808107-42808129 CAGAGAGATGTTTAAGAGGAAGG - Intergenic
1107725363 13:43293426-43293448 GAGGGTGATTGTGGTGAGGATGG - Intronic
1107924588 13:45246477-45246499 CAGGGTGATGGTAAAGGAGTGGG - Intronic
1107967979 13:45614592-45614614 CTGGGAGCTGGTGAAGAAGATGG + Intronic
1108105420 13:47003473-47003495 CAGGTTGAAGGTTAAGATGATGG - Intergenic
1108563141 13:51666503-51666525 CAGGGAGGTGGAGAAGAGGATGG + Intronic
1109162130 13:58988667-58988689 ATGGCTTATGGTGAAGAGGATGG - Intergenic
1109747430 13:66645262-66645284 ATGGGTGATGGGGAGGAGGAAGG - Intronic
1109879487 13:68452120-68452142 CAGTGTGATGGTGAATATAAAGG + Intergenic
1110230564 13:73163199-73163221 GATGGTGATGGTGAGGATGATGG - Intergenic
1110379737 13:74836514-74836536 CAAGGTGATGGTTAGGAGGTGGG - Intergenic
1112485436 13:99815298-99815320 CATGGGGATGGTGTAGATGAGGG + Intronic
1112887852 13:104195411-104195433 CAGGATGAGGCAGAAGAGGAAGG - Intergenic
1113930452 13:113965670-113965692 AATGGTGATGGTGATGATGATGG + Intergenic
1114527071 14:23373103-23373125 CAGGGGGAGGGTGCAGATGAGGG + Exonic
1115103604 14:29733569-29733591 CACGGTAAAGGTGAAGGGGAAGG + Intronic
1115186881 14:30698773-30698795 CAGGGAGATTGTGGAGAGGAAGG + Intronic
1115313181 14:31999964-31999986 CATGGAGATGGTGAATAGAATGG - Intergenic
1115762536 14:36589874-36589896 CAGGGTGAAGGGAAGGAGGAAGG + Intergenic
1116238704 14:42313470-42313492 CACACTGATGATGAAGAGGAAGG - Intergenic
1116319005 14:43435665-43435687 AAGGGTGAGGGTGAAGGTGAGGG + Intergenic
1116947794 14:50852453-50852475 CAGGATGAAGGTGTAGGGGAGGG - Intergenic
1117785743 14:59282603-59282625 CAGTGTGGTGGTGAAGAACATGG + Intronic
1118544505 14:66871775-66871797 CGGGGTGAGGGGGAAGGGGAGGG + Intronic
1118583170 14:67325242-67325264 GAGGGTGAAGAGGAAGAGGAAGG - Intronic
1118729308 14:68655373-68655395 CATGGTGATGGGGGAGGGGAGGG + Intronic
1118963648 14:70559392-70559414 CAGGGTGATAATGATGGGGATGG - Intergenic
1119566458 14:75633244-75633266 CAGGGTCATCAGGAAGAGGAGGG + Intronic
1119691599 14:76677245-76677267 GATGATGATGGTGATGAGGATGG - Intergenic
1119800668 14:77442210-77442232 CAGGGTTATTATGAAGATGAAGG - Intronic
1119874913 14:78050666-78050688 TAGGGTGGGGGTCAAGAGGAGGG - Intergenic
1119999047 14:79282019-79282041 GAGGGGGATGGTGAAAAGAAGGG + Intronic
1120047911 14:79829013-79829035 GAGGGTGATGGTGAGGAAGAAGG - Intronic
1120217940 14:81700507-81700529 CAGAGTGATGCAGAAGAGGAGGG - Intergenic
1120389957 14:83893838-83893860 CAGGGTGACCTTGAAGAGAATGG - Intergenic
1120976941 14:90256988-90257010 AAGGGTGCTGGAGAAGAGGGTGG + Intronic
1121427229 14:93861007-93861029 TAGGGTGATGGTGGAGGGTATGG + Intergenic
1121559974 14:94867175-94867197 TAGGGTGATGGTGGTGATGATGG - Intergenic
1121586502 14:95066550-95066572 GATGGTGATGGTGATGACGATGG - Intergenic
1121590391 14:95101901-95101923 TAGTGTGATGGGGAAGGGGAAGG + Intronic
1121704637 14:95982288-95982310 CAGGGTGCGGGTGATGAGGAGGG - Intergenic
1122298502 14:100718786-100718808 CAGGGTGGCGGTGAAAAGAATGG + Intergenic
1122400474 14:101464544-101464566 GACGGTCATGCTGAAGAGGAAGG + Intergenic
1122482318 14:102055127-102055149 GAGGGTGGAAGTGAAGAGGAGGG - Intergenic
1122519596 14:102334077-102334099 TTGGGTGGTGGTGCAGAGGATGG - Intronic
1122801468 14:104232089-104232111 AATGGTGATGGTGATGATGACGG - Intergenic
1122801474 14:104232132-104232154 AATGGTGATGGTGATGATGATGG - Intergenic
1122884152 14:104703118-104703140 CAACGTGATGGTGAAGAAGCAGG + Exonic
1122907120 14:104806765-104806787 GATGGTGATGGTGAAGATGGAGG - Intergenic
1123178798 14:106447501-106447523 CAGGGTGATAGTGGGGAGAAGGG + Intergenic
1124038850 15:26081913-26081935 TAGCGAGATGGTGAACAGGATGG - Intergenic
1124338797 15:28876654-28876676 CAGGGTGAGGGTGGAGGGGGGGG + Intergenic
1124363098 15:29053327-29053349 CAGTTTGAGGGGGAAGAGGAGGG + Intronic
1125635880 15:41188324-41188346 CAAGGGGAGGGGGAAGAGGAGGG - Intronic
1125767224 15:42143906-42143928 AAGGGTGAGGGAGGAGAGGAGGG - Intronic
1126009671 15:44290519-44290541 CTATGTTATGGTGAAGAGGAGGG - Intronic
1126348367 15:47718852-47718874 CAGGGGCATGGTGAGGAGGAAGG + Exonic
1126348746 15:47722733-47722755 AAGGATGATGGTGATGATGATGG + Intronic
1126397333 15:48232885-48232907 GATGGGGATGGTGATGAGGAGGG - Intronic
1126616201 15:50583404-50583426 CAGGGTGATTGGGAACAGGAGGG - Intronic
1126675201 15:51154975-51154997 GTGGGGGATGGTGAAGAGCAGGG + Intergenic
1126974192 15:54156088-54156110 CAGGGTGATGGTGAAAATGACGG + Intronic
1127007071 15:54582565-54582587 CAGAATGAGGGTGAAGATGAGGG + Intronic
1127279803 15:57479232-57479254 CAAGGTGAGGGTGTGGAGGATGG + Intronic
1127483002 15:59394376-59394398 CAGGATGATGGTGATGAAGATGG + Intronic
1128302043 15:66572149-66572171 CAGTGTGATGGTGTGGATGAGGG - Intergenic
1128388473 15:67166921-67166943 GAGGGAGAGGGCGAAGAGGAAGG - Intronic
1128567402 15:68710545-68710567 CAGGGTGTGGCTGGAGAGGAAGG - Intronic
1128756506 15:70187177-70187199 CATGCTGGTGGTGAATAGGATGG - Intergenic
1128780458 15:70355641-70355663 CAGGGTGAGAGTGATGATGATGG - Intergenic
1129244464 15:74271123-74271145 CAGGGTGATGGGCACGAGGGAGG + Intronic
1129312547 15:74722756-74722778 GAGGGTGAAGGTGTAGAGGTCGG + Exonic
1129822884 15:78616693-78616715 CAGGGAGATGGAGCAGAGGAGGG - Intronic
1129850432 15:78790686-78790708 CAGTGTCATGGTGCAGGGGATGG + Exonic
1130061855 15:80576166-80576188 CAGGGTAACAGCGAAGAGGATGG - Intronic
1130381913 15:83378966-83378988 CGGGGTGGGGGTGAGGAGGAGGG + Intergenic
1130389602 15:83443880-83443902 AAGGGTGATGGTGACGTGAAGGG + Intergenic
1130442739 15:83971664-83971686 CAGAGTGGTGGTGAGGAGGTTGG + Intronic
1130838103 15:87671686-87671708 TAAGGTGATGGTGATGAGGATGG - Intergenic
1130857466 15:87853598-87853620 GATGGTGATGGTGATGATGATGG + Intergenic
1131540335 15:93270146-93270168 CAGGGAGATGAGGAGGAGGAGGG + Intergenic
1132292927 15:100715729-100715751 AGGGGTGATGGGGAAGAAGAGGG - Intergenic
1132309429 15:100846256-100846278 CAGCTTGATGTGGAAGAGGAAGG + Intergenic
1132340203 15:101073487-101073509 CAGGGTGAAGGAGAAGGGGTTGG - Intronic
1132425309 15:101710885-101710907 TGGCGTGGTGGTGAAGAGGAGGG + Intronic
1132844582 16:1993925-1993947 CAGGGTGCAGGTGGAGAGGCAGG - Exonic
1133534971 16:6693125-6693147 GAGGATGATGGTGATGATGATGG - Intronic
1133535018 16:6693455-6693477 GAGGATGATGGTGATGATGATGG - Intronic
1133535046 16:6693685-6693707 GAGGATGATGGTGATGATGATGG - Intronic
1134174926 16:11997965-11997987 TAGGGTGAATGTGAAGATGAAGG + Intronic
1134298979 16:12972773-12972795 GAGGGTGTTGGTGCAGTGGATGG + Intronic
1134449268 16:14353882-14353904 CAGGGGGAGGAAGAAGAGGAGGG + Intergenic
1135402310 16:22174555-22174577 CAGGGTGATGGGGAGTAGGGTGG - Intronic
1135539091 16:23316290-23316312 GATGGTGATGGTGGTGAGGATGG - Intronic
1135539143 16:23316611-23316633 GAGGGTGATGGTGATCATGATGG - Intronic
1135907477 16:26526044-26526066 GATAGTGATGGTGATGAGGATGG - Intergenic
1135949347 16:26898732-26898754 CTGGGTGATGGTGTTGGGGAAGG - Intergenic
1136366282 16:29810678-29810700 CAGGGGGAGGGAGGAGAGGAAGG + Exonic
1136909144 16:34132581-34132603 CAGGTTGAGGGTGGGGAGGAGGG + Intergenic
1137540283 16:49357068-49357090 CAGGGTGGGGCTGCAGAGGAAGG - Intergenic
1137943216 16:52709247-52709269 CTGGGTGGTGGTGGAGAGCAGGG - Intergenic
1137977299 16:53042456-53042478 TAGGGAGAGGGAGAAGAGGAGGG - Intergenic
1138073374 16:54016198-54016220 TAGCATAATGGTGAAGAGGAGGG - Intronic
1138535583 16:57658582-57658604 GTAGGTGATGGTGATGAGGAAGG + Intronic
1138809606 16:60133438-60133460 AAGGGTGATGGTTAAGATGATGG + Intergenic
1138913752 16:61436875-61436897 CTGCATGATGGTGAAGAGGGAGG + Intergenic
1139302173 16:65954792-65954814 CCAGGTGATGCTGATGAGGATGG - Intergenic
1139344270 16:66292486-66292508 CAGGATGATTGAGAGGAGGAGGG - Intergenic
1139946263 16:70644690-70644712 CAGGGTGAGGAGGAGGAGGAGGG + Intronic
1140591160 16:76354476-76354498 CAGGGTGGTGGGTAAGAGGATGG - Intronic
1140834847 16:78783795-78783817 GAGGGTGATGGTGATGATGATGG + Intronic
1141001525 16:80312768-80312790 CAGGGTGACGGGGAAGAGGGTGG - Intergenic
1141066201 16:80916017-80916039 CACGGTGGTGGGCAAGAGGAAGG - Intergenic
1141089499 16:81120680-81120702 CAGGGTGTTGGAGAAGACGATGG + Intergenic
1141213175 16:81999845-81999867 CAGGGTGGAGGTGAAGAGGCAGG + Exonic
1141553689 16:84822798-84822820 CTGGGTGGTGGTTAATAGGATGG + Intronic
1141712764 16:85709667-85709689 CAGGGAGAGGGTGAGGAGGTGGG - Intronic
1141731062 16:85823316-85823338 GATGGTGATGGTGATGATGAAGG - Intergenic
1141817119 16:86419146-86419168 AATGGTGATGGTGATGATGATGG + Intergenic
1141817135 16:86419257-86419279 GATGGTGATGGTGATGATGATGG + Intergenic
1141817144 16:86419320-86419342 GATGGTGATGGTGATGATGATGG + Intergenic
1141817179 16:86419494-86419516 GATGGTGATGGTGATGATGATGG + Intergenic
1141817211 16:86419737-86419759 AATGGTGATGGTGATGATGATGG + Intergenic
1141843189 16:86587912-86587934 GATGGTGATGGTGATGATGATGG - Intergenic
1141872739 16:86799475-86799497 GAGGATGATGGTGATGAGGATGG - Intergenic
1141880071 16:86852068-86852090 GATGGTGATGGTGATGATGATGG - Intergenic
1141880099 16:86852299-86852321 GATGGTGATGGTGATGATGATGG - Intergenic
1141891741 16:86930795-86930817 CAGCGTGATGGAGGAAAGGAGGG - Intergenic
1141928085 16:87182342-87182364 CATGGGGATGGTGATGAGGAGGG - Intronic
1141931771 16:87209819-87209841 CATGGTGATGGTGATGATGGTGG + Intronic
1141932250 16:87213728-87213750 GATGGTGATGGTGATGATGATGG + Intronic
1141988768 16:87597696-87597718 GATGGCGATGGTGATGAGGATGG - Intergenic
1142103532 16:88289221-88289243 GAGGGTGATGATGATGATGAAGG + Intergenic
1142103539 16:88289275-88289297 GAGGGTGATGGTGATGATGATGG + Intergenic
1142112333 16:88339384-88339406 CAGGGGGATGGGGGACAGGATGG + Intergenic
1142112395 16:88339541-88339563 CAGGGGGATGGGGGACAGGATGG + Intergenic
1142118207 16:88371864-88371886 AATGGTGATGGTGACGATGATGG - Intergenic
1142118251 16:88372146-88372168 GATGGTGATGGTGACGATGATGG - Intergenic
1142118267 16:88372254-88372276 GATGGTGATGGTGACGATGATGG - Intergenic
1142118292 16:88372428-88372450 GATGGTGATGGTGATGATGATGG - Intergenic
1142443940 16:90121966-90121988 GAGGGTGAGGGTGAGGATGAGGG + Intergenic
1142472800 17:172543-172565 CTTGGTGATGGTGCAGTGGAGGG + Exonic
1142507991 17:377584-377606 GAGGGGGATGGGGAAGGGGAGGG + Intronic
1142623426 17:1179020-1179042 GAGGGTGGTGGTGATGATGAGGG + Intronic
1142898694 17:2998952-2998974 GATGGTGAGGGTGGAGAGGAGGG + Intronic
1143002498 17:3803609-3803631 AGGGGTGAGGGAGAAGAGGAGGG + Intergenic
1143332830 17:6150083-6150105 CAGAGGGTTGGTCAAGAGGAAGG - Intergenic
1143336719 17:6176999-6177021 CAGGGTGATGTGGAAGAAAACGG - Intergenic
1143448883 17:7023973-7023995 CGGGGTGATAGTGAGGAGGCGGG + Intronic
1143515439 17:7417345-7417367 CAGGATGTTGAGGAAGAGGAGGG - Exonic
1143557944 17:7674192-7674214 CAGTGTGATGATGGTGAGGATGG + Exonic
1143758875 17:9086888-9086910 GATGGTGATGGTGAAGCTGATGG - Intronic
1143887557 17:10076247-10076269 CAGGGGGACGGGGAAGGGGAGGG + Intronic
1143936608 17:10492448-10492470 CAAGCTGAGGGTGAAGAGCAGGG - Exonic
1144077319 17:11731046-11731068 GATGGTGATGGTGATGATGATGG + Intronic
1144190130 17:12837969-12837991 CAGGGTGATGGGAAAGCGGAGGG - Intronic
1144231110 17:13204819-13204841 CTGGGTGATGGTGAAACTGACGG + Intergenic
1145347841 17:22052917-22052939 TAAGGTGATGATGATGAGGATGG - Intergenic
1145958801 17:28873382-28873404 AAGGGTGCTGGAGAGGAGGAAGG - Intergenic
1146377829 17:32306514-32306536 CAGTGTGATAGTGAAGAACATGG + Intronic
1147041137 17:37719983-37720005 CATGATGATGGTGATGATGATGG - Intronic
1147041680 17:37724140-37724162 CCAGGTGCTGTTGAAGAGGATGG - Intronic
1147258139 17:39194370-39194392 AAGGGTGATGGTGACGGGGGTGG - Intronic
1147873113 17:43601788-43601810 CAGGGTAATCGTGAGGAGGCAGG - Intergenic
1149351530 17:55793003-55793025 CAGGGTGAGGTTGAAGGGCATGG - Intronic
1149511278 17:57243747-57243769 AAGGGTGGTGGAGAGGAGGAAGG + Intergenic
1149523483 17:57336143-57336165 CAGGGTGGTGGTGAGGACGGTGG + Intronic
1149561195 17:57609104-57609126 CAGGGAGATGGTGAAGAGGAGGG - Intronic
1150285283 17:63950627-63950649 CAGGCTGATGGTGCAGGGGTGGG + Intronic
1150328471 17:64275510-64275532 AGGGGTGATGGGCAAGAGGAAGG - Intergenic
1150645917 17:66977403-66977425 CTGTGTGATGGTCAATAGGACGG + Intronic
1151027286 17:70693343-70693365 AAGGGTGGAGGTTAAGAGGAGGG - Intergenic
1151228827 17:72667163-72667185 AAGGGTGTAGGTGAAGAGGCAGG + Intronic
1152026060 17:77810138-77810160 GATGGTGATGGTGATGATGATGG + Intergenic
1152026062 17:77810156-77810178 GATGGTGATGGTGATGATGATGG + Intergenic
1152026069 17:77810201-77810223 CATGGTGATGGTGATGGTGATGG + Intergenic
1152075755 17:78158724-78158746 TAGTGTGAGGGGGAAGAGGAGGG - Intronic
1152161266 17:78669962-78669984 CAGGGTGATGCTGAAACGTAAGG + Intergenic
1152441696 17:80313682-80313704 GATGGTGGTGGTGAAGGGGATGG + Intronic
1152470435 17:80488017-80488039 GAGGGACATGGTGGAGAGGATGG + Intergenic
1152470465 17:80488126-80488148 GAGGGACATGGTGGAGAGGATGG + Intergenic
1152470483 17:80488198-80488220 GAGGGACATGGTGGAGAGGATGG + Intergenic
1152470502 17:80488270-80488292 GAGGGACATGGTGGAGAGGATGG + Intergenic
1152470557 17:80488486-80488508 GAGGGACATGGTGGAGAGGATGG + Intergenic
1152470576 17:80488558-80488580 GAGGGACATGGTGGAGAGGATGG + Intergenic
1152470606 17:80488667-80488689 GAGGGACATGGTGGAGAGGATGG + Intergenic
1152470624 17:80488739-80488761 GAGGGACATGGTGGAGAGGATGG + Intergenic
1152470643 17:80488811-80488833 GAGGGACATGGTGGAGAGGATGG + Intergenic
1152470707 17:80489028-80489050 GAGGGACATGGTGGAGAGGATGG + Intergenic
1152470726 17:80489100-80489122 GAGGGACATGGTGGAGAGGATGG + Intergenic
1152658685 17:81532142-81532164 GATGGTGATGGTGATGATGATGG + Intronic
1152659502 17:81535756-81535778 GAGGGGGATGGGGATGAGGATGG - Intronic
1152693918 17:81734461-81734483 CCGGGTGATGGTGACGGTGACGG - Intergenic
1152740167 17:82015273-82015295 CGAGGGGATGGTGGAGAGGAGGG - Exonic
1152921029 17:83066778-83066800 CAGGGTGAGGGTGCAGAGGGCGG - Intergenic
1152921074 17:83066948-83066970 CAGGGTGAGGGTGCAGAGGGCGG - Intergenic
1152921098 17:83067033-83067055 CAGGGTGAGGGTGCAGAGGGCGG - Intergenic
1153748944 18:8209821-8209843 CAGGGTGAGGGGTAAGGGGAGGG + Intronic
1153795893 18:8621762-8621784 GAGGGTGATGGGTAGGAGGAAGG - Intronic
1155417658 18:25617212-25617234 GATGGTGGTGGTGAAGGGGAAGG + Intergenic
1156361185 18:36386251-36386273 CAGGGAGATGAGGCAGAGGACGG - Intronic
1156521362 18:37724688-37724710 CAGGGTCCTGGTGAGGAGCAGGG - Intergenic
1157411948 18:47470547-47470569 GAGGGTGATGGTGAGGGGCAGGG - Intergenic
1157899394 18:51499654-51499676 CAGCATGATGTTGAAAAGGAGGG - Intergenic
1157975888 18:52326288-52326310 ATGGGTGATGGTGACCAGGATGG - Intergenic
1158546358 18:58400743-58400765 CAGAGTTATGGTCACGAGGAAGG - Intronic
1158823343 18:61186645-61186667 CAGAGTGATGGGAAAGAGTAGGG - Intergenic
1159527433 18:69610998-69611020 GAGGATGATGGTGAGGTGGATGG + Intronic
1159628720 18:70724704-70724726 CAGGGTCAGGTTGAAGACGAGGG + Intergenic
1159840938 18:73398496-73398518 CAGCGTGAAGATGATGAGGATGG - Intergenic
1160277863 18:77455170-77455192 GATGGTGATGGTGATGATGATGG + Intergenic
1160384523 18:78486778-78486800 CATGCTGATGAAGAAGAGGATGG - Intergenic
1160777023 19:861193-861215 CGGGGTGAGGGTGCAGAGGGTGG - Intronic
1161156170 19:2732859-2732881 CAGGAAGGTGATGAAGAGGAAGG + Exonic
1161374653 19:3933315-3933337 GAGGGTGGGGGTGGAGAGGAGGG + Intronic
1161536886 19:4824968-4824990 AAGGGTGGTGGTGAGGAGGAGGG + Intronic
1161899404 19:7106888-7106910 GATGGTGATGGTGATGATGATGG + Intergenic
1161899428 19:7107093-7107115 GATGGTAATGGTGATGAGGATGG + Intergenic
1161899450 19:7107363-7107385 GATGGCGATGGTGATGAGGATGG + Intergenic
1161899465 19:7107520-7107542 GATGGTGAAGGTGATGAGGATGG + Intergenic
1162184778 19:8896348-8896370 CATGGTGATGTTGAAAATGAAGG - Intronic
1162186739 19:8910998-8911020 GAGTGTGATGGTGATGATGATGG - Intronic
1162393810 19:10404840-10404862 CAGGGTGGAGGGGAAGAGGGAGG - Intronic
1162536916 19:11268074-11268096 GGGGGTGATGGTGAAGAGGGAGG + Intergenic
1162585040 19:11553277-11553299 CACGGTGCTGGTGAGGAGGCTGG + Exonic
1163157860 19:15449215-15449237 CAGGGAGATGGTGGGGAGGCCGG + Intronic
1163715719 19:18870880-18870902 CAGGGAGGAGGGGAAGAGGAAGG - Intronic
1164071656 19:21775164-21775186 CAGGGTGATGGAGAGGGAGAGGG - Intergenic
1165397864 19:35577003-35577025 CAAGCAGATGGTGAAGAGGGAGG + Intergenic
1165796594 19:38523511-38523533 GAGGGAGATGGAGAGGAGGAGGG - Intronic
1167044068 19:47039703-47039725 CAGGGTGATGGGGAGAAGGGAGG + Intronic
1167092004 19:47350880-47350902 GAGGGTGATGATGAACAAGACGG + Intronic
1167130514 19:47582246-47582268 CAAGGGGAGGATGAAGAGGAGGG - Intergenic
1167270739 19:48504294-48504316 CAGCGTGAGGGTAAAGGGGAGGG - Intronic
1167301461 19:48680322-48680344 CAGGGTGATTCTGAAGATGGGGG - Intergenic
1167305017 19:48703267-48703289 CAGGGTGATTCTGAAGATGGGGG - Exonic
1167325587 19:48822872-48822894 AATGGTGATGGTGAGGATGACGG + Intronic
1167334043 19:48873729-48873751 GAGGGAGTTGCTGAAGAGGAGGG + Exonic
1167640376 19:50678463-50678485 GAGGGTGAAGGTGATGAGGCAGG + Intronic
1167749360 19:51370641-51370663 CAGGGTGAAGGGCAAGAAGAAGG - Intergenic
1167797229 19:51717236-51717258 CAGGCTGATGCTTGAGAGGAAGG + Intronic
1167898734 19:52602161-52602183 CAGAGTGAGGGAGAGGAGGAGGG + Intronic
1167903162 19:52637398-52637420 CAGAGTGAGGGAGAGGAGGAGGG - Intronic
1167904556 19:52648019-52648041 CAGAGTGAGGGAGAGGAGGAGGG - Intronic
1167909336 19:52689502-52689524 CAGGGTGAGGGAGAGGAGGAGGG - Intronic
1167913847 19:52724795-52724817 CAGAGTGAGGGAGAGGAGGAGGG - Intronic
1167921351 19:52785791-52785813 CAGAGTGAGGGAGAGGAGGAGGG - Intronic
1167925858 19:52820649-52820671 CAGAGTGAGGGAGAGGAGGAGGG - Intronic
1167930044 19:52856638-52856660 CAGAGTGAGGGAGAGGAGGAGGG - Intronic
1167934179 19:52892870-52892892 CAGAGTGAGGGAGAGGAGGAGGG - Intronic
1167940355 19:52941693-52941715 CAGAGTGAGGGAGAGGAGGAGGG - Intronic
1167946372 19:52992360-52992382 CAGAGTGAGGGAGAGGAGGAGGG - Intergenic
1167991819 19:53366666-53366688 CAGGGTGAGGGAGAGGAGGAGGG + Intronic
1167995211 19:53396116-53396138 CAGAGTGAGGGAGAGGAGGAGGG + Intronic
1167999469 19:53432912-53432934 CAGGGTGAGGGAGAGGAGGAGGG + Intronic
1168003841 19:53469673-53469695 CAGGGTGAGGGAGAGGAGGAGGG + Intronic
1168517384 19:57018836-57018858 CAGGTTGATGATGAAGAGCCTGG - Intergenic
925439903 2:3876516-3876538 GAGAGTGAGGGTGAGGAGGATGG + Intergenic
925897317 2:8482603-8482625 GATGGTGATGGTGATGATGATGG + Intergenic
925902177 2:8516515-8516537 GAGGGTGAAGGTGAGGAGGCAGG - Intergenic
926117355 2:10221821-10221843 CAGGGTGATGATGATGAAGATGG + Intergenic
926120716 2:10239925-10239947 CAGGGTGCTGTTGGGGAGGAAGG + Intergenic
926132431 2:10312565-10312587 GATGGTGATGATGATGAGGATGG - Intronic
926709294 2:15864476-15864498 TAGGCTGAAGGGGAAGAGGAAGG - Intergenic
926791066 2:16572264-16572286 CAGGGTCATAATGAAGATGATGG + Intronic
926964758 2:18397645-18397667 GAGGAAGAGGGTGAAGAGGAAGG - Intergenic
927289548 2:21392534-21392556 AAAGATGTTGGTGAAGAGGATGG + Intergenic
927485236 2:23484251-23484273 CAGGCTGGTTGTGAAGAGAATGG + Intronic
927678418 2:25123750-25123772 CAGGGTGGTGGGGGAGTGGATGG + Intronic
928042380 2:27890973-27890995 CAGCGTGATGGGGATGAGAAGGG - Exonic
928054191 2:28034700-28034722 CAGAGAGGTGGAGAAGAGGAAGG + Intronic
928276192 2:29902359-29902381 CAGGATGATGGAGAAGAGGATGG - Intronic
928280461 2:29941826-29941848 GATGGTGATGGTGATGATGATGG - Intergenic
928649098 2:33386277-33386299 GAAGGTGAGGGTGAAGAGGAAGG - Intronic
928778108 2:34790774-34790796 AAGGGTGAAGGAGAAGAGGTTGG - Intergenic
928989338 2:37215871-37215893 CTGGGTGATGGTAATGGGGAGGG + Intronic
929076902 2:38085557-38085579 CAGGGTGAAGGAGAAGGGGTTGG + Intronic
929242284 2:39665693-39665715 GAGGGGGCTGGGGAAGAGGAGGG + Intronic
929466292 2:42147462-42147484 GAGTGTGGTGGTGAAGAGCATGG - Intergenic
929886642 2:45884392-45884414 CAGGGTGGTGGTGAGGAAGGAGG + Intronic
930369672 2:50487182-50487204 GAGGATGATGGTGATGATGATGG + Intronic
930485186 2:52002472-52002494 CAAGGTGATGGTGAGGAGGTGGG - Intergenic
930684259 2:54290733-54290755 CAGGGTGAGGGTGAAAACGCAGG + Intronic
931042484 2:58315106-58315128 CAGGGTGAAGGAGAAGGGGTTGG - Intergenic
931063420 2:58556797-58556819 GAGGTTGATGGTGAAGGAGATGG + Intergenic
931253010 2:60550354-60550376 CGGGGTGATGGGGGAGAGAAAGG + Intronic
931686096 2:64795386-64795408 CCAGGAGATGGTGGAGAGGAAGG + Intergenic
931999430 2:67870781-67870803 CAGAGGAATGGTGATGAGGATGG - Intergenic
932047955 2:68368913-68368935 CAGGGTGATGGGAAAGGGAAGGG + Intronic
932187703 2:69713110-69713132 CAGGGTGGTGGTTGAGAGTAAGG - Intronic
932530860 2:72530934-72530956 CAGGTTGAAAGTGAAAAGGAAGG - Intronic
933383120 2:81576387-81576409 AATGGTAATGGTGAAGAGAATGG + Intergenic
933810943 2:86032351-86032373 GAGGGTGATGAGGAAGAGGAGGG - Exonic
936718478 2:115218966-115218988 CAGTGTGATGGGTATGAGGATGG - Intronic
937090928 2:119205680-119205702 CAGGGTGATGCTGAAGTGTAGGG - Intergenic
937175865 2:119934136-119934158 CAAGGTGGTGGTTAAGAGCATGG + Intronic
937682328 2:124657388-124657410 AATGGAGATGGTGAAGAGGAAGG - Intronic
937880927 2:126864012-126864034 CTGGGTGATGGGGCAGAGGCTGG - Intergenic
938181943 2:129191826-129191848 CAGGGAGCTGGGGAAGAGCAGGG - Intergenic
938263860 2:129912660-129912682 CAGGGTGAGGGCACAGAGGAGGG + Intergenic
938696385 2:133838923-133838945 CAGTGAGATGGTGAAGGAGAGGG + Intergenic
938984235 2:136557985-136558007 CAGGATTAAGGTGAAGAGGAAGG - Intergenic
939507978 2:143072492-143072514 CAGGGAAATGTTGAATAGGAGGG + Intergenic
939634438 2:144564084-144564106 CATGGTGGTGGTGACGAGAATGG + Intergenic
940146975 2:150555742-150555764 CAGAATGTTGGAGAAGAGGATGG - Intergenic
940290625 2:152074597-152074619 GATGGTGATGGTGGAGAGGAGGG - Intronic
940301536 2:152180717-152180739 CACGCTGATGATGAGGAGGAAGG - Intergenic
940529979 2:154868274-154868296 CAGGGTGAAGGAGAAGGGGTTGG - Intergenic
940676026 2:156724870-156724892 CAGGGTGAAGGAGAAGGGGTTGG + Intergenic
940722953 2:157301606-157301628 CCAGATGAAGGTGAAGAGGAAGG + Intronic
940725873 2:157335568-157335590 CTAGGTGATGGTGAGGAGGCAGG - Intergenic
941629254 2:167865975-167865997 TAGGATGATGGGGAGGAGGATGG - Intergenic
941983439 2:171485915-171485937 AAGGGTGAAGGTGGAAAGGAGGG + Intergenic
942213788 2:173698012-173698034 GAGGATGATGGTGATGATGATGG - Intergenic
942213801 2:173698201-173698223 GATGGTGATGGTGATGACGATGG - Intergenic
942392938 2:175515028-175515050 CAGAGTGATGGTTATGAGGATGG + Intergenic
942739530 2:179158989-179159011 GAGGGTGAAGGTGAGGAGAAAGG + Intronic
943265753 2:185729747-185729769 CAGGGTCATCGTGCAGAGTATGG + Intergenic
944213253 2:197228287-197228309 CAGGGTGGTGGTGAACAGTTAGG + Intronic
944636717 2:201681975-201681997 CAGTCTGATGGGGAAGAAGAGGG + Intronic
944657603 2:201891566-201891588 CAGGGTAATCTTGAGGAGGAAGG + Intronic
945148965 2:206767858-206767880 CAGAATGATAGTGAAGGGGATGG + Intronic
945985783 2:216352404-216352426 CAGGGTGAGTGTGCAGAGAAAGG + Intronic
946047802 2:216835742-216835764 CAGGGTGTTGAGGCAGAGGATGG - Intergenic
946160485 2:217832782-217832804 CAGAGTGAGGGTGAAGGGCAGGG - Intronic
946254515 2:218433006-218433028 CCGGGAGATGGAGAAGGGGATGG + Intronic
946886291 2:224226278-224226300 AAGGGTGAAGGAGAAGGGGATGG - Intergenic
947350330 2:229236741-229236763 GAGGGTGATGTGGAAGACGATGG + Intronic
947480863 2:230498870-230498892 CGTGGTGATGGGCAAGAGGAGGG - Intronic
947545113 2:231005091-231005113 GATGGTGATGGTGATGAGGATGG - Intronic
947545127 2:231005172-231005194 GATGGTGATGGTGATGATGATGG - Intronic
947587030 2:231362625-231362647 CAGTGTGAGGAAGAAGAGGATGG + Intronic
947597361 2:231421524-231421546 CAGGGAGATGTAGAAGGGGATGG - Intergenic
947619361 2:231578850-231578872 GATGGTGATGGTGATGATGATGG - Intergenic
947619396 2:231579750-231579772 GATGGTGATGGTGATGATGATGG - Intergenic
947619400 2:231579780-231579802 AATGGTGATGGTGATGATGATGG - Intergenic
947796269 2:232896025-232896047 GAGGGTGACGGGGAAGAGGAAGG - Intronic
948495648 2:238346933-238346955 CTGGGTGAAGGTGCAGAGGTGGG + Intronic
948641000 2:239375878-239375900 GAGGGTGCTGGAGAAGAGGGGGG + Intronic
948671988 2:239574687-239574709 CAGGGTGAGAGTGAAGTGGGTGG - Intergenic
949045917 2:241872592-241872614 GAGGGTGTTGGTGAAGATGCTGG - Exonic
1168947550 20:1774045-1774067 CTGGGTCATGGAGAAGAGGCTGG + Intergenic
1169488049 20:6049864-6049886 GATGGTGATGGTGATGATGAAGG - Intronic
1169745685 20:8940270-8940292 GAGGGTGATGGTGGAGATGCTGG - Intronic
1169815649 20:9653572-9653594 CAGGATGATGCAGAAGAGAAAGG - Intronic
1170303477 20:14911955-14911977 CAGGGTGTTGGTCAAGATTATGG - Intronic
1171045219 20:21804347-21804369 CTGAGTCATGGTGAAGAAGATGG - Intergenic
1171233821 20:23508807-23508829 CAGGGTGTAGGAGCAGAGGAGGG - Intergenic
1171267479 20:23783524-23783546 TATGGTGATGGTGATGATGATGG - Intergenic
1171878881 20:30602042-30602064 GATGGTGATGGTGATGATGATGG - Intergenic
1171979459 20:31617363-31617385 CAGGGTAATGGCCAAGGGGAAGG - Intergenic
1172181160 20:33004380-33004402 CTGGGAGCTGGTGAGGAGGAAGG + Exonic
1172292091 20:33783988-33784010 GAGGGAGATGGAGAAGTGGAGGG - Intronic
1172292109 20:33784056-33784078 GAGGGAGATGGGGAGGAGGAGGG - Intronic
1172292123 20:33784092-33784114 GAGGGAGATGGGGAGGAGGAAGG - Intronic
1172292196 20:33784292-33784314 CAGGGAGATGGGGAAGAAGAGGG - Intronic
1172408695 20:34707055-34707077 CTGGGTGAAGATGAAGAGGGAGG - Intronic
1172532925 20:35646072-35646094 AGGGGTGATGGTGGAGTGGAGGG - Intronic
1172649791 20:36494748-36494770 TAGGGAGAGGGTGAAGGGGAGGG - Intronic
1173115062 20:40233492-40233514 CAAGGTCATGGTGAAGAAGGAGG - Intergenic
1173180786 20:40804845-40804867 CAGGGTGGTGGAGGAGAAGATGG - Intergenic
1173539965 20:43843869-43843891 CAGAGTGTGGGTGAAGAGGAAGG + Intergenic
1173726083 20:45298743-45298765 GATGGTGATGGTGATGATGATGG - Intronic
1173771964 20:45667434-45667456 CTGGGTGATTGTGGAGTGGAAGG + Intronic
1173878021 20:46388540-46388562 CAGGGAGATGGTGAATGGGTAGG + Intronic
1173948223 20:46968546-46968568 CTGGGGGGTGGTGAAGGGGAGGG - Intronic
1174086366 20:48010928-48010950 GAAGGTGATGGTGATGATGAAGG - Intergenic
1174868928 20:54165481-54165503 CAGGGTGGTGGGGCAGGGGAGGG - Intronic
1175252352 20:57617089-57617111 CTAGGAGATGGTGAAGAGGAAGG - Intronic
1175284340 20:57827837-57827859 CTGGGGGATGGGGAAGGGGATGG + Intergenic
1175728719 20:61337235-61337257 AATGGTGGTGGTGAAGATGATGG + Intronic
1175764909 20:61585627-61585649 GACGGTGATGGTGATGATGATGG + Intronic
1175891254 20:62317014-62317036 CAGGATGATGCTGCAGCGGAAGG + Exonic
1175906477 20:62382111-62382133 GACGGTGATAGTGAAGATGATGG + Intergenic
1175962953 20:62646270-62646292 GAGGGTGAAGGTGAGGAGGCAGG - Intronic
1176167304 20:63680938-63680960 CAGGGTGATGCTGGTGAGGGAGG + Intronic
1176278372 20:64286996-64287018 CAGGGTGAGGGTGAGGGTGAGGG + Intronic
1176872875 21:14098011-14098033 GATGGTGATGGTGATGATGATGG - Intergenic
1176872913 21:14098310-14098332 GATGGTGGTGGTGAAGATGATGG - Intergenic
1177204227 21:17993360-17993382 GAGGGTGATGGGTGAGAGGAGGG - Intronic
1178105169 21:29310404-29310426 CATGGTGATGGTGATGAGGGTGG + Intronic
1178617674 21:34147577-34147599 CAGTGTGATGGTGAGAAGGATGG + Intergenic
1178935716 21:36859868-36859890 CAAGGAGATGGGGAAGAAGACGG + Intronic
1178974545 21:37209683-37209705 TTGGGAGATGGTGAAGAGCAGGG - Intergenic
1179353002 21:40631187-40631209 CAGGCTGGTGGAGCAGAGGAGGG - Intronic
1179633166 21:42691147-42691169 GATGGTGATGGTGAAGGGGCTGG - Intronic
1179633266 21:42691706-42691728 GATAGTGATGGTGAAGAGGCTGG - Intronic
1180042445 21:45287442-45287464 CAGGGTGATGGTATAGGGGCAGG - Intronic
1180176102 21:46090712-46090734 CTTGGTGATGGTGATGATGATGG + Intergenic
1180176125 21:46090838-46090860 CTTGGTGATGGTGATGATGATGG + Intergenic
1180184867 21:46134491-46134513 CAGGGTGAGGGTGAGGGTGAGGG + Intergenic
1180184907 21:46134623-46134645 CAGGGTGAGGGTGAGGGTGAGGG + Intergenic
1180317304 22:11285979-11286001 CAGGTTGAGGGTGGGGAGGAGGG - Intergenic
1180857274 22:19056464-19056486 GCCTGTGATGGTGAAGAGGAAGG + Intronic
1181054057 22:20251513-20251535 GGTGGTGATGGTGATGAGGATGG - Intronic
1181054072 22:20251642-20251664 GATGGTGATGGTGATGAGGATGG - Intronic
1181054089 22:20251771-20251793 GCTGGTGATGGTGATGAGGATGG - Intronic
1181054097 22:20251840-20251862 GATGGTGAGGGTGATGAGGATGG - Intronic
1181130158 22:20726515-20726537 CTGGGGGATGTAGAAGAGGATGG + Exonic
1181339533 22:22166728-22166750 CAGGGTGTTGTTGACTAGGAGGG - Intergenic
1181552993 22:23651675-23651697 CAGGGAGTTGAGGAAGAGGAGGG + Intergenic
1181893074 22:26081816-26081838 CAGGATAAGCGTGAAGAGGAAGG + Intergenic
1181960772 22:26620253-26620275 AATGGTGATGATGAAGATGATGG + Intergenic
1181981451 22:26769635-26769657 AAGGGTGATGGTGCTGAGGCTGG + Intergenic
1182057300 22:27369661-27369683 CAGAGTGAGGGGGAGGAGGAGGG + Intergenic
1182151030 22:28027276-28027298 CAGGGTGCTGGCCAAGAGAAGGG + Intronic
1182327423 22:29524359-29524381 CAGGGTGCTTGTGAAGAGTCAGG - Intronic
1182350001 22:29694048-29694070 CAGGGAGATGTGGAAGGGGATGG - Intronic
1182351349 22:29701791-29701813 CAGGGTGCAGGTGGAGGGGATGG - Intergenic
1182476468 22:30579234-30579256 GAAGGTGATGGTGATGAAGAGGG - Exonic
1182852024 22:33483468-33483490 GAGGGTGATGGTGAACAGATAGG + Intronic
1182916583 22:34038404-34038426 GATGATGATGGTGAAGATGAAGG - Intergenic
1183080684 22:35454183-35454205 CAGGAAGGTGGTGAAGGGGAAGG - Intergenic
1183206936 22:36426251-36426273 CAGGGAGAGGAGGAAGAGGAAGG - Intergenic
1183231273 22:36583683-36583705 CATGGTGATGGTGAGAAGGAAGG - Intronic
1183268133 22:36843464-36843486 CTTGGTGATGGTGATGATGATGG + Intergenic
1183351233 22:37335933-37335955 GAGGGAGATGGGGAAGAAGAGGG - Intergenic
1183394245 22:37562170-37562192 CAGGGTGGGGGTGAAGACGATGG - Intronic
1183587186 22:38759680-38759702 CAGGGTGTTGGTGACAATGACGG - Intronic
1183728076 22:39600467-39600489 CAGGGTGAGGTTGCAGAGCAGGG - Intronic
1183862149 22:40678114-40678136 CAGGGTGATTCTGAAGAACAGGG - Intergenic
1184263831 22:43335780-43335802 GATGGTGATGGTGATGATGATGG + Intronic
1184287785 22:43481754-43481776 CAGCTTGAGGGTGAAGGGGATGG - Intronic
1184289675 22:43491867-43491889 GATGGTGATGGTGATGATGATGG + Intronic
1184292406 22:43504907-43504929 CATGGTGATAGTGATGATGATGG + Intronic
1184292436 22:43505183-43505205 GGTGGTGATGGTGACGAGGATGG + Intronic
1184342149 22:43891896-43891918 CGGGGTGATCGGGACGAGGAAGG + Exonic
1184519661 22:44985807-44985829 CATGGTGATGGTGATGGTGATGG - Intronic
1184519690 22:44985978-44986000 CATGGTGATGGTGATGAGGATGG - Intronic
1184534965 22:45080300-45080322 GATGGTGATGGTGATGAGGATGG - Intergenic
1184833932 22:47009349-47009371 GATGGTGATGGTGATGATGATGG - Intronic
1184833940 22:47009428-47009450 GATGGTGATGGTGATGATGATGG - Intronic
1184833947 22:47009508-47009530 GATGGTGATGGTGAAGATGATGG - Intronic
1184837824 22:47034468-47034490 CGTGGTGATGATGAAGAGGAGGG + Intronic
1185060721 22:48605254-48605276 GAGGGTGATGGTGAGGATGATGG + Intronic
1185110315 22:48896856-48896878 GAGGCTGATGGGGAGGAGGAAGG + Intergenic
1185136188 22:49074226-49074248 GATGGTGATGGTGATGATGATGG - Intergenic
1185200489 22:49500650-49500672 TAAGGTGATGGTGATGATGATGG - Intronic
1185209585 22:49562773-49562795 AATGGTGATGGTGATGATGATGG - Intronic
1185262185 22:49873715-49873737 CAGGGTGGGGGTGATGAGGTGGG - Intronic
949671834 3:6406302-6406324 CAGAGTGGGGGTGGAGAGGAAGG + Intergenic
949985790 3:9539510-9539532 CTGGTTGTTGGTGGAGAGGATGG - Intronic
950120987 3:10482507-10482529 CAGGCTGATGGTGAGGAGAAGGG + Intronic
950233463 3:11296797-11296819 CTGAGTGATGTTGAAAAGGATGG - Intronic
950926275 3:16745229-16745251 AAGGGTGATGGAGAAGGGGTTGG - Intergenic
951335969 3:21422138-21422160 CATAGTGATGGTGAAGAAGGAGG + Intronic
951799031 3:26574627-26574649 CATGGTGATAGTGAACATGATGG - Intergenic
953311877 3:41888602-41888624 AAGGGTGATGGAAAAGAGGCAGG - Intronic
953340995 3:42134172-42134194 GAGGGGGAAGGGGAAGAGGAAGG - Intronic
953385476 3:42503407-42503429 AAGGGTGGTGGTTAACAGGAGGG + Intronic
953772251 3:45786950-45786972 CAGGGAGGTGGTGATGAGTAAGG - Intronic
953913663 3:46905123-46905145 CAGGGAGATGGTGACAGGGAGGG + Intergenic
954135552 3:48580588-48580610 CAGGGAGATCCTGGAGAGGATGG - Exonic
954135677 3:48581138-48581160 CAGGGTGAAGTTGGAGAGAAAGG - Exonic
954309947 3:49758404-49758426 CTGGCTGATGGAGAAGTGGATGG - Intronic
954432906 3:50480809-50480831 GAGGGGGAGGGTAAAGAGGAAGG + Intronic
955444513 3:58995206-58995228 TAGAGTGATGGGGCAGAGGAAGG - Intronic
955638715 3:61058628-61058650 CAGGTAGAAGGTGAAGAGGAAGG - Intronic
956145058 3:66183824-66183846 CAGGGTGAGGGTGAGGATGAAGG - Intronic
956145761 3:66189206-66189228 CAGGGTGATGGTTAAGGTCAGGG - Intronic
956146790 3:66198735-66198757 TAGGCTGATGGTAAAGATGAGGG - Intronic
956772510 3:72538449-72538471 CAGGGTGATGGTGATGGGGGTGG - Intergenic
957355700 3:79082852-79082874 CAGGTTGATGGTGTGGAGGGAGG + Intronic
958983565 3:100753903-100753925 CAGTGGCATGGTGAAGATGATGG + Intronic
958985618 3:100776705-100776727 GAGGGTGAGGGTGGAGAGCAGGG + Intronic
959232070 3:103667247-103667269 CAAAGTGCTGGAGAAGAGGAAGG - Intergenic
959425232 3:106178982-106179004 CTGGGTGATGGTGATGCTGAGGG + Intergenic
961091406 3:124115651-124115673 CAGGGTGAAGCTGAAAAAGAAGG - Intronic
961614084 3:128164930-128164952 CTGGATGAAGGAGAAGAGGAAGG + Intronic
966995562 3:185276674-185276696 CAGGGTGAGGGTCAAGTAGATGG + Intronic
967071024 3:185962358-185962380 TAGGGTGATGGTAAAGATGTTGG + Intergenic
967793135 3:193570553-193570575 CAGGGTGACAGTGAACAGAAGGG + Intronic
968009611 3:195265393-195265415 CAAGGTGATGGGAAAGATGAAGG + Intronic
968448553 4:664395-664417 CAGGGAGATGGTGCAGAGCTGGG + Intronic
968589949 4:1452561-1452583 GAAGGTGATGGTGATGAGGATGG - Intergenic
968590042 4:1453385-1453407 GATGGTGATGGTGATGGGGATGG - Intergenic
968592842 4:1467739-1467761 TATGGTGATGGTGATGATGATGG + Intergenic
968592893 4:1468111-1468133 GATGGTGATGGTGATGATGATGG + Intergenic
968592894 4:1468123-1468145 GATGATGATGGTGAAGATGATGG + Intergenic
968592896 4:1468141-1468163 GATGGTGATGGTGATGATGATGG + Intergenic
968592899 4:1468180-1468202 GATGGTGATGGTGATGATGATGG + Intergenic
968602120 4:1514647-1514669 CATGGTGATGGTGATGGTGATGG + Intergenic
968602188 4:1515146-1515168 GATGGTGATGGTGGAGATGATGG + Intergenic
968900959 4:3431572-3431594 GAGTGTGAAGGTGAACAGGATGG + Intronic
969208809 4:5670607-5670629 GATGGTGATGGTGAAGATGATGG - Intronic
969208821 4:5670721-5670743 GATGGTGATGGTGAAGATGATGG - Intronic
969208844 4:5670892-5670914 GATGGTCATGGTGAAGATGATGG - Intronic
969256322 4:6004332-6004354 GATGGTGATGGTGATGATGACGG + Intergenic
969281077 4:6171034-6171056 CATGGTGATGGTGGTGAGGGTGG - Intronic
969458969 4:7317571-7317593 CAGGCCCATGGGGAAGAGGAAGG - Intronic
969541142 4:7789539-7789561 GATGGTGATGATGAAAAGGATGG - Intronic
969541154 4:7789604-7789626 GATGGTGAGGATGAAGAGGATGG - Intronic
969625420 4:8302545-8302567 CAGGGTGAGGGATGAGAGGAAGG - Intronic
969628514 4:8321284-8321306 GAGGGTAATGGTGATGATGATGG - Intergenic
969628523 4:8321353-8321375 GAGGGTGATGGTGGTGATGATGG - Intergenic
970506352 4:16734604-16734626 CAGGGGGCTGGGGCAGAGGAAGG - Intronic
971054649 4:22898483-22898505 GAGGGTGGTGGTGAAGAGCTTGG + Intergenic
971066110 4:23035224-23035246 CAGGGGGAGGGTGAAGAGAGTGG + Intergenic
971178947 4:24309439-24309461 CAGGGTGAGGTTGCAGAGGTAGG + Intergenic
971330312 4:25676358-25676380 CAGGATGATGATGAAGACGACGG - Exonic
971548879 4:27923589-27923611 CAGGGAGTAGGTGAAGAGAAAGG + Intergenic
972464668 4:39343567-39343589 CATGGTGCAGGGGAAGAGGAAGG - Intronic
972712433 4:41610777-41610799 TAGGGTAATGGTTAAGAGAATGG - Intronic
972776729 4:42248186-42248208 AAAGGAGATGGGGAAGAGGAAGG + Intergenic
974024589 4:56722202-56722224 CAGGGTGCTGGAGAAGAGCCTGG + Intergenic
975300641 4:72786755-72786777 CCAGGTGATGTTGAAAAGGAAGG + Intergenic
976884780 4:89969508-89969530 CAGGGTGAAGGAGAAGAGGTTGG + Intergenic
977192899 4:94022567-94022589 CAAGGAGATTGAGAAGAGGAAGG + Intergenic
977649057 4:99448394-99448416 GAGGGTGAAGGTTGAGAGGAGGG - Intergenic
978672672 4:111269856-111269878 AAGGGTGATGGTACAGAGGGAGG - Intergenic
978827434 4:113042265-113042287 CAGGGTGAGGGTGGAGAGGCTGG - Intronic
978856273 4:113398223-113398245 GAGGGAGAAGGAGAAGAGGATGG - Intergenic
978921791 4:114192878-114192900 CAGGATGATGGTGAAGGACAAGG - Intergenic
979054815 4:115980312-115980334 CAGGGTGAAGGAGAAGGGGTTGG + Intergenic
979690432 4:123553475-123553497 GAGGGTTAGGGTGAAGTGGAGGG - Intergenic
979817536 4:125128766-125128788 CAGGGAGAGGGAGATGAGGAAGG - Intergenic
980200278 4:129648152-129648174 TAGGGGGAAGGGGAAGAGGAGGG + Intergenic
980388701 4:132119127-132119149 CAGGGTGAAGGAGAAGGGGTTGG - Intergenic
980507491 4:133741436-133741458 CAGGGTGAAGGTTAGGAGGAGGG - Intergenic
980550518 4:134328451-134328473 CAAGGTGATGGTGATGAAGGGGG + Intergenic
980866323 4:138557078-138557100 CAGGGTGAAGGTGAAGGAAATGG + Intergenic
981509572 4:145541109-145541131 CAGGTTAGTGGTGAGGAGGAAGG - Intronic
981629109 4:146797638-146797660 CAGGGTGAGGTGGGAGAGGAAGG - Intronic
982157966 4:152539994-152540016 CACGTTGCGGGTGAAGAGGAGGG - Intergenic
982309868 4:153973715-153973737 ATGGCAGATGGTGAAGAGGAAGG - Intergenic
984212684 4:176869956-176869978 GAGGGTGGTGGGGAAGGGGATGG - Intergenic
985034772 4:185827702-185827724 GATGGTGATGGTGATGATGATGG - Intronic
985034778 4:185827759-185827781 GATGGTGATGGTGATGATGATGG - Intronic
985117258 4:186604726-186604748 GAGTGTGGTGGTGAGGAGGAGGG + Intronic
985118399 4:186615426-186615448 GAATGTGATTGTGAAGAGGATGG - Intronic
985470082 5:35879-35901 CAGGGTGAGGGTCTAGGGGAGGG + Intergenic
985561276 5:587366-587388 TAGGGTTATGGTGAGCAGGAAGG + Intergenic
985571332 5:647135-647157 AAGGGTGATGGTGACACGGATGG - Intronic
985808201 5:2063768-2063790 CAGGGTGTGGGGGAAGGGGAGGG + Intergenic
986436748 5:7741629-7741651 GATGGTGATGGTGATGATGATGG - Intronic
986828619 5:11550269-11550291 CAGGGTGGTGGTGAAGACAACGG - Intronic
987078024 5:14402652-14402674 GAGGGTAAGGGTGTAGAGGAAGG + Intronic
988641360 5:33043822-33043844 CTGGAAGATGGAGAAGAGGAAGG + Intergenic
988735984 5:34021764-34021786 CAGGGTGAGGGGAAAGGGGAGGG + Intronic
988782353 5:34533778-34533800 CAGGCAGATGGGGAAGAGGGGGG - Intergenic
990212203 5:53492534-53492556 CAAGGTTCTGGTGAAGAGGATGG - Intergenic
991339088 5:65585669-65585691 AAGGGAGAGGGAGAAGAGGAGGG + Intronic
992199741 5:74371388-74371410 CAGGGTCATCGTGAAAAGCATGG + Intergenic
992949601 5:81845424-81845446 AAGTGTGATGGTGAATAGTAGGG + Intergenic
994095413 5:95843232-95843254 CAGTGTGGTGGTGAAGAGCGTGG + Intergenic
994471302 5:100211551-100211573 GAGGGTGGAGGTCAAGAGGAGGG + Intergenic
996344169 5:122471798-122471820 AAGGATGAGGGTGAGGAGGAGGG - Intergenic
997130818 5:131274218-131274240 AGGGGTGATGGAGAAGAGGGAGG - Intronic
997304350 5:132826933-132826955 CAGGCTGTTGGGGAACAGGAGGG - Intronic
997663163 5:135604804-135604826 CAGTGTGGTGGTCAAGAGCATGG + Intergenic
997879864 5:137579914-137579936 CTGGGCCATGGTGAAGAGGCTGG + Intronic
999871868 5:155760123-155760145 GAGGGTGATGGAGATGATGATGG - Intergenic
999871873 5:155760159-155760181 GAGGGTGTTGGTGAGGATGATGG - Intergenic
999871879 5:155760195-155760217 GAGGGTGTTGGTGAGGATGATGG - Intergenic
999871887 5:155760231-155760253 GAGGGTGATGGAGATGATGATGG - Intergenic
999871891 5:155760255-155760277 GAGGGTGATGCTGAGGATGATGG - Intergenic
999871909 5:155761385-155761407 GAGGGTGATGGAGATGATGATGG - Intergenic
999871917 5:155761433-155761455 GAGGGTGATGGTGAGGATGATGG - Intergenic
999871922 5:155761457-155761479 GAGGGTGATGGTGAGGATGATGG - Intergenic
999871929 5:155761493-155761515 GAGGGTGATGGAGAGGATGATGG - Intergenic
999871936 5:155761539-155761561 GAGGGTGATGGTGAGGATGATGG - Intergenic
999871954 5:155761680-155761702 GAGGGTGATGGAGAGGATGATGG - Intergenic
999871960 5:155761715-155761737 AAGGGCAATGGTGAAGATGATGG - Intergenic
999871973 5:155761796-155761818 AAGGTTGATGGTGAGGATGATGG - Intergenic
999896664 5:156041463-156041485 AAGAGAGATGGTGGAGAGGAGGG + Intronic
1000161907 5:158606067-158606089 CAATGTGAAGATGAAGAGGACGG - Intergenic
1000182253 5:158822725-158822747 CAGGAGGGTGGTAAAGAGGATGG + Intronic
1001327457 5:170739506-170739528 CAGGGTGATGGTGAGTACCAAGG - Intergenic
1001337369 5:170810550-170810572 AAGGGTGATAGTTAAGAGCATGG - Intronic
1001542653 5:172550356-172550378 CTGGGTCATGGAGCAGAGGAAGG - Intergenic
1001645270 5:173276697-173276719 CAGGGTGAGGGGCAAGGGGAGGG + Intergenic
1001676359 5:173520266-173520288 CCTGGTGATGGGGGAGAGGAAGG - Intergenic
1002602465 5:180361842-180361864 CATGGTGATTGTGGAGAGGTGGG + Intergenic
1002762767 6:214664-214686 AAGGGAGAAGGTGAATAGGAAGG + Intergenic
1003055676 6:2817731-2817753 TTGGGTGCTGGTGAAGAAGAAGG + Intergenic
1003286058 6:4734699-4734721 GATGGGGATGGGGAAGAGGATGG + Intronic
1004115378 6:12761725-12761747 CAGGGAGAGGGTGAAGAAAAAGG - Intronic
1004377645 6:15104548-15104570 GATGGTGGTGGTGAAGAGGAAGG - Intergenic
1004575015 6:16886927-16886949 CAGGGTGAAGGAGAAGGGGTTGG - Intergenic
1005681004 6:28208071-28208093 CAGCGTGATGGTTAAGAGCATGG + Intergenic
1006057141 6:31393731-31393753 AAGGTTGATGGTGGTGAGGATGG + Intergenic
1006147330 6:31967494-31967516 AAGGGAGAGGGTGAAAAGGAGGG - Intronic
1006173392 6:32108159-32108181 CAGGGTCAGGGAAAAGAGGAGGG + Intronic
1006374159 6:33662725-33662747 CAGGATGGTGGGGAAGAGGGAGG - Intronic
1006403224 6:33829780-33829802 CAGGGAGGTGAGGAAGAGGAGGG - Intergenic
1006403237 6:33829835-33829857 CAGGGAGGTGAGGAAGAGGAGGG - Intergenic
1006403250 6:33829890-33829912 CAGGGAGGTGAGGAAGAGGAGGG - Intergenic
1006403275 6:33830000-33830022 CAGGGAGGTGAGGAAGAGGAGGG - Intergenic
1006567746 6:34974165-34974187 AAGGGGGAAGGGGAAGAGGAAGG - Intronic
1007017467 6:38483128-38483150 CAGAGAAATGATGAAGAGGATGG - Intronic
1007369720 6:41418369-41418391 AGGGGTGATGGTGGTGAGGATGG - Intergenic
1007428096 6:41760048-41760070 CACAGTGATGGGGAAGAGAAAGG + Intergenic
1007503408 6:42315857-42315879 CAGGCAGAGGCTGAAGAGGAGGG + Intronic
1008124163 6:47649811-47649833 CAGGAGGAGGGTGAAGAGGCAGG + Intergenic
1008535853 6:52505688-52505710 AAGGGTGAGGATGAAGAGGCGGG + Exonic
1008872353 6:56287569-56287591 CATGGTAAAGGCGAAGAGGAAGG - Intronic
1009244575 6:61220446-61220468 CAGTGAGAGAGTGAAGAGGATGG + Intergenic
1011161041 6:84390645-84390667 CAGAGTGAAGGTGCAGAGGGAGG + Intergenic
1011792463 6:90913425-90913447 CAGGGGGATGGTGAGGAGGAGGG - Intergenic
1011898404 6:92260969-92260991 ATGGCAGATGGTGAAGAGGAAGG - Intergenic
1012238888 6:96850007-96850029 CAGGGTGGAGGTTGAGAGGAGGG + Intergenic
1012688799 6:102287696-102287718 GAGGTAGGTGGTGAAGAGGAAGG + Intergenic
1015194901 6:130515072-130515094 AAGGATGATGGAAAAGAGGAAGG + Intergenic
1015434693 6:133172477-133172499 CAGGCTGTTGGTGTGGAGGAGGG - Intergenic
1015645225 6:135379968-135379990 GAGGGAGAGGGTGAAGGGGAGGG - Intronic
1015729528 6:136334317-136334339 CATGGTGTTGGTGATAAGGAAGG + Intergenic
1015782985 6:136890565-136890587 CACGGTGATGGGGGTGAGGAGGG - Intronic
1016424723 6:143922453-143922475 CAGGGTGCTGGTGGAGAGGTTGG - Intronic
1017362532 6:153592861-153592883 CAGTGCCATGGTGAAGACGAGGG - Intergenic
1017720186 6:157238399-157238421 GAGGGTGATGGTGATGATGATGG + Intergenic
1017720199 6:157238462-157238484 TATGGTGATGGTGATGATGAGGG + Intergenic
1017720214 6:157238510-157238532 GAGGGTGATGGTGATGGGGGTGG + Intergenic
1017775715 6:157679352-157679374 CAGGGTCATGGAGGAGAGAAGGG - Intergenic
1018208901 6:161461303-161461325 GAGGGGGATGGTGGAGAGGGAGG + Intronic
1018285219 6:162230443-162230465 CAGGGGAAGAGTGAAGAGGAAGG + Intronic
1018961054 6:168448630-168448652 GATGGTGATGGGGAGGAGGATGG + Intronic
1018996609 6:168715067-168715089 GAGGATGATGGTGAAGAGGAGGG + Intergenic
1019223914 6:170495472-170495494 CAGAGCGGTGGTGAAGAGGATGG + Intergenic
1019223948 6:170495629-170495651 CAGAGCGGTGGTGAAGAGGATGG + Intergenic
1019224135 6:170496466-170496488 CAGAGCGGTGGTGAAGAGGATGG + Intergenic
1019224143 6:170496503-170496525 CAGAGCGGTGGTGAAGAGGATGG + Intergenic
1019224169 6:170496620-170496642 CAGAGCGGTGGTGAAGAGGATGG + Intergenic
1019288885 7:237604-237626 AATGGTGATGGTGATGATGATGG + Intronic
1019353605 7:567541-567563 GAAGGTGATGGTGATGATGATGG - Intronic
1019360454 7:601933-601955 CAGGGGGATGGGGAGGGGGAAGG + Intronic
1019369560 7:654061-654083 GATGGTGATGGTGATGAAGATGG - Intronic
1019369567 7:654112-654134 GATGGTGATGGTGATGAAGATGG - Intronic
1019369571 7:654168-654190 GATGGTGATGGTGATGAAGATGG - Intronic
1019369595 7:654401-654423 GATGGTGATGGTGATGAAGATGG - Intronic
1019369627 7:654681-654703 GATGGTGAAGGTGATGAGGATGG - Intronic
1019666061 7:2252815-2252837 AGGGGTGATGGGGAATAGGAGGG - Exonic
1019770359 7:2880552-2880574 CAGGGCGATGATGGAGAGAAAGG + Intergenic
1019831735 7:3336863-3336885 CAGGGTGATGGTGGGGAGTGGGG + Intronic
1019841680 7:3452737-3452759 CAGGGTGGTGGAGGAGGGGAGGG - Intronic
1020939823 7:14518310-14518332 GAGGGTGAAGATTAAGAGGAGGG + Intronic
1021508859 7:21413863-21413885 AAGGATGATGATGAAGAGGAGGG + Intergenic
1021637102 7:22704271-22704293 CAGGGTGAAGGAGAAGGGGTTGG - Intergenic
1022656658 7:32325468-32325490 CAGAGTGCTGGGGAAGGGGATGG - Intergenic
1022957782 7:35397325-35397347 CAGGGTGAGGGGACAGAGGATGG - Intergenic
1022998225 7:35780531-35780553 GAGGGTGATGGTGAAAACTAAGG + Intergenic
1023039447 7:36159671-36159693 CAGGGTCTTGGGGAAAAGGAGGG + Intronic
1023362949 7:39434220-39434242 CAGGGAAATGGGAAAGAGGATGG + Intronic
1023616921 7:42029366-42029388 CAGAGTGCTGGGGCAGAGGACGG + Intronic
1023641933 7:42268113-42268135 CACTGGGATGGTGGAGAGGAGGG - Intergenic
1023803562 7:43855231-43855253 CAGGGTCATGGTGAGGATAAGGG + Intergenic
1023882586 7:44328695-44328717 GATGGTGATGGTGATGATGAAGG + Intronic
1023990180 7:45124096-45124118 CAGGGGGGTGGTGGGGAGGAGGG + Intergenic
1024121706 7:46248613-46248635 GAGAGTGAAGATGAAGAGGAGGG - Intergenic
1024230984 7:47363299-47363321 GATGGTGATGGTGATGATGATGG - Intronic
1024278679 7:47700002-47700024 GATGGTGATGGTGAAGGTGATGG - Intronic
1024330556 7:48150566-48150588 CAGGGTCATTGTGAAGATCAAGG + Intergenic
1024469125 7:49748988-49749010 GAGGGAGGTGGTGAAGAAGAGGG - Intergenic
1024514100 7:50229429-50229451 GGGGGTGATGGGAAAGAGGAAGG + Intergenic
1024524398 7:50336272-50336294 CAGGGGGAGGGTGCAGAGGGAGG + Intronic
1025610475 7:63072395-63072417 CGGGGAGATGGGGGAGAGGAGGG - Intergenic
1025612182 7:63084214-63084236 CAGGAAGATGGTAAAGAAGATGG - Intergenic
1025942443 7:66083997-66084019 CAGGGAGTTGAGGAAGAGGAGGG - Intronic
1025994971 7:66522362-66522384 AAGGGTGAGGGTGAAGAGGCAGG + Intergenic
1026113261 7:67475300-67475322 GATGGTGATGGTGATGATGATGG + Intergenic
1026405048 7:70056390-70056412 CAGGGTGAAGGTGATGAAGGAGG - Intronic
1026617001 7:71914195-71914217 GAGGGTGGAGGTTAAGAGGAGGG - Intronic
1026986606 7:74559057-74559079 AAGGGTGAGGGTGAAGAGGCAGG + Intronic
1028121535 7:87060425-87060447 CTAGGTGATGGTGAACAAGATGG + Intergenic
1028128305 7:87140542-87140564 AAGGGTCAAGGTGAAAAGGAGGG + Intergenic
1029202874 7:98850819-98850841 AGGGGTGATGGTGATGAGGGAGG + Intronic
1029385793 7:100242740-100242762 CAGGGTGATTATGGAGAGGCAGG + Intronic
1029457437 7:100678348-100678370 GAGGGTGAGGGTGAGGAGCAGGG - Intronic
1029846574 7:103418122-103418144 TGTGGGGATGGTGAAGAGGAGGG - Intronic
1030281302 7:107778243-107778265 CAGGACAATGGTGAAGATGAAGG + Exonic
1030328617 7:108248959-108248981 CAGGATGATGATGATGATGATGG + Intronic
1030421775 7:109315546-109315568 GAGGGTGGTGGTTGAGAGGAGGG + Intergenic
1030766674 7:113419019-113419041 CATGGTGATGGCGTAAAGGAGGG + Intergenic
1031866089 7:127039903-127039925 GAGGGGGAAGGTGAAGGGGAAGG + Intronic
1031944673 7:127826886-127826908 CAGGGAGATGGCTAAGAGGGTGG - Intronic
1031990196 7:128192634-128192656 GAGGGGGATGGTGGGGAGGAGGG - Intergenic
1032461975 7:132118620-132118642 CAGTGTGATGGTGAAGACCACGG - Intergenic
1032610562 7:133408186-133408208 TAGGGTGATGGTGATGATGGAGG + Intronic
1032650381 7:133871652-133871674 CAGGAGGAAGGAGAAGAGGATGG - Intronic
1032859822 7:135866319-135866341 CATGGTGATGATGAGGAGGAGGG - Intergenic
1033215125 7:139487744-139487766 GAAGGTGAAGGTGAAGGGGAGGG + Intergenic
1033560101 7:142522707-142522729 GAAGGTGAGGGTGCAGAGGAAGG - Intergenic
1033587802 7:142787266-142787288 CAGGGTGATGGGGCAGAAGAGGG + Intergenic
1033909700 7:146248252-146248274 CAGGGTGAAGGAGAAGGGGTTGG + Intronic
1033982719 7:147186147-147186169 CTGGGTGAAAGTGAAGAAGATGG + Intronic
1034953629 7:155318071-155318093 GAAGGTGATGGTGATGATGATGG - Intergenic
1034969806 7:155411838-155411860 CATGATGATGGTGATGATGATGG - Intergenic
1035035479 7:155891575-155891597 AGAGGTGATGGTGAAGGGGATGG + Intergenic
1035170589 7:157015283-157015305 CAGGGAGAGGCTGAGGAGGAGGG - Intergenic
1035310706 7:157966324-157966346 GATGGTGGTGGTGAAGATGATGG - Intronic
1035340170 7:158155460-158155482 GATGGTGATGGTGATGATGATGG - Intronic
1035340172 7:158155478-158155500 GATGGTGATGGTGATGATGATGG - Intronic
1035340184 7:158155592-158155614 GATGGTGATGGTGATGATGATGG - Intronic
1035342699 7:158174333-158174355 GATGATGATGGTGAAGATGATGG - Intronic
1035492794 7:159294822-159294844 TAGGGTGAAGGTGAGGATGAAGG + Intergenic
1035659649 8:1337377-1337399 GATGGTGATGGTGAGGATGATGG + Intergenic
1035659653 8:1337404-1337426 GATGGTGATGGTGAGGATGATGG + Intergenic
1035777419 8:2198961-2198983 CGGGGTGTTTGAGAAGAGGAAGG + Intergenic
1035931997 8:3790332-3790354 GATGGTGATGGTGATGATGATGG + Intronic
1036704030 8:11033183-11033205 GAGGATGATGGTGATGAGGATGG + Intronic
1036991694 8:13605404-13605426 CAGGGCAGTGGTGAAAAGGACGG - Intergenic
1037733187 8:21546528-21546550 CAGAGTGATGGAGATGAGGCTGG - Intergenic
1037904689 8:22708982-22709004 GATGGTGATGGTGATGATGATGG - Intergenic
1037904697 8:22709047-22709069 GATGGTGATGGTGATGATGATGG - Intergenic
1037904733 8:22709398-22709420 GATGGTGATGGTGATGATGATGG - Intergenic
1037904735 8:22709416-22709438 GATGGTGATGGTGATGATGATGG - Intergenic
1037904739 8:22709457-22709479 GATGGTGATGGTGATGATGATGG - Intergenic
1038245945 8:25856170-25856192 TAGTGTGGTAGTGAAGAGGATGG - Intronic
1038395506 8:27242948-27242970 CAGAGGGATGGTGGTGAGGACGG - Intronic
1038416704 8:27401881-27401903 GATGGTGATGGTGATGATGATGG + Intronic
1038424902 8:27458718-27458740 CAGGGTGACGGTGACAAAGATGG + Exonic
1038513866 8:28167019-28167041 CACAGTGATGGTGAAGAATAAGG + Intronic
1038686789 8:29726233-29726255 AAGGATGAAGGTGAAGATGAAGG - Intergenic
1038781221 8:30569700-30569722 GATGGTGATGGTGGAGTGGAAGG + Intronic
1039897375 8:41725742-41725764 CAAGGTGAGGGCGAGGAGGAGGG - Exonic
1040318776 8:46278742-46278764 CACACTGATGATGAAGAGGAAGG + Intergenic
1041465650 8:58155337-58155359 CAGGGTGAGAGTGGAGAGAATGG - Intronic
1041633189 8:60111489-60111511 TATCGTGATGGTGAAGAGCATGG - Intergenic
1041975494 8:63794621-63794643 CAGGGTGATGATGCTAAGGAAGG - Intergenic
1042540554 8:69903554-69903576 GAGGCTGGTGGGGAAGAGGACGG + Intergenic
1043329382 8:79095663-79095685 GATGGGGATGGAGAAGAGGATGG + Intergenic
1044600177 8:93996027-93996049 AAGGGTGATGGGAAAGAGAAGGG - Intergenic
1044798992 8:95933858-95933880 CAGGGTGAGGCGGAAGAGCAAGG - Intergenic
1045176553 8:99731314-99731336 CAGGGTTATAGTGAAGATAATGG - Intronic
1045392918 8:101733062-101733084 AGGGGTGAGGGTGAAGAGGATGG - Intronic
1046011518 8:108554222-108554244 GAGGGTGAAGGTTAGGAGGAGGG + Intergenic
1047095613 8:121622020-121622042 AAGGGTGAAGGTTAAGATGAAGG - Intronic
1047305307 8:123648293-123648315 GAGTGTGGTGGTGAAGAGCATGG - Intronic
1048007130 8:130428481-130428503 GATGGTGATGGTGATGAAGATGG - Intronic
1048116272 8:131526859-131526881 CAGGGTGTTGGTGATGAGGGTGG + Intergenic
1048193828 8:132315336-132315358 CAGTGTGATAGTGAAGAGGAGGG + Intronic
1048574543 8:135680398-135680420 CAGGGAGATGATGAAGACGCCGG - Intergenic
1049274676 8:141714023-141714045 GATGGTGATGGTGATGATGATGG + Intergenic
1049274680 8:141714059-141714081 GATGGTGATGGTGATGATGATGG + Intergenic
1049324132 8:142013119-142013141 GATGGTGATGGTGATGATGAAGG - Intergenic
1049445626 8:142629629-142629651 GATGGTGATGGTGATGATGATGG - Intergenic
1050490861 9:6186556-6186578 GAGGGAGAAGGTGAAGGGGAAGG + Intergenic
1051187541 9:14475819-14475841 CATGGAGATGGTAAAGGGGATGG - Intergenic
1051374381 9:16388895-16388917 CAGGGTGGTGGTGAAGAACAGGG - Intergenic
1051681167 9:19609393-19609415 CAGGAGGCTGGTGAAGAGGCTGG - Intronic
1051745401 9:20290645-20290667 CAGGGTGAGGGGAAAGAGCAGGG + Intergenic
1051922672 9:22286376-22286398 CATGGTGATTATGAAGGGGAAGG + Intergenic
1052330223 9:27260134-27260156 CAGGGTGCTGCAGAAGAGGGAGG + Intergenic
1053596709 9:39569950-39569972 CAGGCTCATGGTGAACAGGGAGG - Intergenic
1053854679 9:42326597-42326619 CAGGCTCATGGTGAACAGGGAGG - Intergenic
1054569545 9:66795052-66795074 CAGGCTCATGGTGAACAGGGAGG + Intergenic
1054728363 9:68675435-68675457 CAGGGAGCTGGAGATGAGGATGG + Intergenic
1054947346 9:70810125-70810147 CAGGGTGATGGAAAGGAGGGTGG - Intronic
1054947364 9:70810192-70810214 CAGGGTGATGGAGAGGAGGGTGG - Intronic
1054947398 9:70810326-70810348 CAGGGTGATGGAGAGGAGGGTGG - Intronic
1054947414 9:70810393-70810415 CAGGGCGATGGAGAGGAGGGTGG - Intronic
1055780908 9:79820592-79820614 CAGGTGTTTGGTGAAGAGGAGGG - Intergenic
1056094833 9:83242350-83242372 CAGGCTGATTGAGGAGAGGATGG + Intergenic
1056469404 9:86890750-86890772 AATGGTGATGGTGATGATGATGG + Intergenic
1056577281 9:87866003-87866025 CTGATGGATGGTGAAGAGGAAGG + Intergenic
1056580195 9:87884553-87884575 CAGGGTTATGGTGGAGAGGGCGG - Intronic
1056689068 9:88790571-88790593 AAGTGTGATGGTGAAAATGATGG + Intergenic
1057185141 9:93053218-93053240 CAGAGGGCTGGTGAAGAGGCAGG + Intergenic
1057267028 9:93624274-93624296 GATGGTGATGGTGAAGGTGATGG + Intronic
1057267089 9:93624804-93624826 GATGGTGATGGTGATGATGATGG + Intronic
1057445699 9:95112930-95112952 CTGAGTGATGGTGGAGAGGGTGG + Intronic
1057822624 9:98344142-98344164 CAGAGCGATGGAGAAGAGAAGGG - Intronic
1058175567 9:101732603-101732625 GAGGGAGAGGGTAAAGAGGAAGG + Intronic
1058203959 9:102078623-102078645 CAGTGTGGTGGTGGAGAGGGAGG + Intergenic
1058315882 9:103565134-103565156 CAGGGTGAGGGAGGAGAAGATGG + Intergenic
1058321521 9:103636889-103636911 CAGACTGATGGTGAAGAGAGAGG - Intergenic
1058372546 9:104286416-104286438 CAGTGTGATGGTAAAGAACAGGG - Intergenic
1058935421 9:109765425-109765447 CATGATGATGGTGATGAAGACGG - Intronic
1059672460 9:116504341-116504363 CAAGGTGAGGGCAAAGAGGACGG + Intronic
1059757237 9:117304872-117304894 CAGGCTGAGGGTGGGGAGGAGGG + Intronic
1059790436 9:117636508-117636530 GAGGGTCATGGTGAAGTGGTTGG - Intergenic
1059847815 9:118301053-118301075 CAGTGTGTTGGAAAAGAGGATGG + Intergenic
1060404139 9:123364777-123364799 CAGGGTGATGGTGAAGAGGAAGG - Intronic
1060941188 9:127543785-127543807 CAGTGTGATGGAGGAGAGGATGG - Intronic
1061394803 9:130338047-130338069 CAGGGTGATGGGGGACAGGGAGG - Intronic
1061473165 9:130843651-130843673 CGAGGTGATGGGGAGGAGGAAGG + Intronic
1061511755 9:131065889-131065911 CAAGATGATGATGAAGATGATGG + Intronic
1061808635 9:133149765-133149787 GAGGGAGGTGGGGAAGAGGAGGG - Intergenic
1062314310 9:135958573-135958595 CAGGCAGATGGAAAAGAGGAAGG + Intronic
1062326115 9:136013322-136013344 CAGGGTGAGGATGATGGGGAGGG + Intronic
1062552856 9:137098046-137098068 CAGGGGGATGCTGAAGGGCAAGG - Intronic
1062588824 9:137263824-137263846 CAGGGTTCTGGGGAAGGGGAGGG - Intronic
1062748929 9:138236961-138236983 GAGGGTGAGGGTGAGGATGAGGG + Intergenic
1185689061 X:2138168-2138190 CATGATGATGGTGATGATGATGG - Intergenic
1185721170 X:2382666-2382688 GATGGTGATGGTGATGATGATGG - Intronic
1185721182 X:2382789-2382811 GACGGTGATGGTGATGATGATGG - Intronic
1185721218 X:2383200-2383222 AATGATGATGGTGATGAGGATGG - Intronic
1185739631 X:2520847-2520869 GAGGATGATGGTGATGATGATGG - Intergenic
1185854829 X:3524416-3524438 GATGGTGATGGTGATGATGATGG - Intergenic
1186266427 X:7839200-7839222 CAGAGAGAAGGTGAAGAAGAAGG + Intergenic
1187086743 X:16049455-16049477 CAGGGTGAAGGAGAAGGGGTTGG + Intergenic
1188283555 X:28300587-28300609 GATGGTGATGGTGATGATGATGG - Intergenic
1188973766 X:36649056-36649078 CAGGCTGATGCTGAAGAAGAAGG + Intergenic
1189559938 X:42182063-42182085 CAGGGTCAGCGTGAGGAGGAGGG + Intergenic
1190000822 X:46684972-46684994 CAGGGTGAAGGAGAAGAGGTAGG - Intronic
1190506964 X:51135927-51135949 TATGGTGAAGGTGAAGAGGAAGG - Intergenic
1191255022 X:58276007-58276029 CAGGGGGATGGTGAAGTCCAGGG - Intergenic
1191662494 X:63665809-63665831 CCTGGGGATGATGAAGAGGAGGG + Intronic
1192671187 X:73143724-73143746 GACGGGGATGGTGATGAGGAAGG - Intergenic
1194041647 X:88948823-88948845 CATGATGATGATGAGGAGGATGG - Intergenic
1194070981 X:89325918-89325940 CAGGGAAAAGGTAAAGAGGAAGG - Intergenic
1194459819 X:94152441-94152463 CAGGGTTATGGAGAAGAAGGGGG - Intergenic
1194747311 X:97642193-97642215 TAGGGTGATGGTGATGAAGATGG - Intergenic
1195007520 X:100701023-100701045 CAGGGTGGTGGTTATGAGTAGGG + Intronic
1195065107 X:101233152-101233174 CAGGGTGATGGAGAATAGTATGG + Intronic
1197347675 X:125344638-125344660 CATGGTGCTGGTGAAGTGGAAGG + Intergenic
1198322047 X:135527848-135527870 TAGGGAGATGGTGAAGGGCAGGG + Intronic
1199109270 X:143910886-143910908 ATGGCAGATGGTGAAGAGGAAGG + Intergenic
1200091280 X:153637281-153637303 CAGAGAGAAGGTGGAGAGGAGGG - Intergenic
1200725211 Y:6661659-6661681 CAGGGAAAAGGTAAAGAGGAAGG - Intergenic
1200808680 Y:7459976-7459998 GATGGTGATGGTGATGATGATGG + Intergenic
1200808682 Y:7459994-7460016 GATGGTGATGGTGAAGATGATGG + Intergenic
1201072113 Y:10156433-10156455 AAGGGTGATGGTGTAGAGTGAGG - Intergenic
1201143578 Y:11048538-11048560 GATGGTGATGGTGATGATGATGG + Intergenic
1201768380 Y:17594294-17594316 GATGGTGATGGTGATGATGATGG - Intergenic
1201833173 Y:18311691-18311713 GATGGTGATGGTGATGATGATGG + Intergenic
1202036063 Y:20637257-20637279 CAGTGATATGTTGAAGAGGACGG + Intergenic
1202140222 Y:21713715-21713737 CATACTGATGGTGAGGAGGAAGG + Intergenic