ID: 1060406197

View in Genome Browser
Species Human (GRCh38)
Location 9:123374231-123374253
Sequence AGCCACTGCCAGATGAATAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060406197_1060406206 5 Left 1060406197 9:123374231-123374253 CCCTTATTCATCTGGCAGTGGCT No data
Right 1060406206 9:123374259-123374281 GGGAGCCCAGCGTGTGGAAGGGG No data
1060406197_1060406210 17 Left 1060406197 9:123374231-123374253 CCCTTATTCATCTGGCAGTGGCT No data
Right 1060406210 9:123374271-123374293 TGTGGAAGGGGATCTGGCTGTGG No data
1060406197_1060406201 -1 Left 1060406197 9:123374231-123374253 CCCTTATTCATCTGGCAGTGGCT No data
Right 1060406201 9:123374253-123374275 TCTCCCGGGAGCCCAGCGTGTGG No data
1060406197_1060406209 11 Left 1060406197 9:123374231-123374253 CCCTTATTCATCTGGCAGTGGCT No data
Right 1060406209 9:123374265-123374287 CCAGCGTGTGGAAGGGGATCTGG No data
1060406197_1060406205 4 Left 1060406197 9:123374231-123374253 CCCTTATTCATCTGGCAGTGGCT No data
Right 1060406205 9:123374258-123374280 CGGGAGCCCAGCGTGTGGAAGGG No data
1060406197_1060406204 3 Left 1060406197 9:123374231-123374253 CCCTTATTCATCTGGCAGTGGCT No data
Right 1060406204 9:123374257-123374279 CCGGGAGCCCAGCGTGTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060406197 Original CRISPR AGCCACTGCCAGATGAATAA GGG (reversed) Intronic