ID: 1060406201

View in Genome Browser
Species Human (GRCh38)
Location 9:123374253-123374275
Sequence TCTCCCGGGAGCCCAGCGTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060406198_1060406201 -2 Left 1060406198 9:123374232-123374254 CCTTATTCATCTGGCAGTGGCTC 0: 1
1: 0
2: 0
3: 8
4: 133
Right 1060406201 9:123374253-123374275 TCTCCCGGGAGCCCAGCGTGTGG No data
1060406197_1060406201 -1 Left 1060406197 9:123374231-123374253 CCCTTATTCATCTGGCAGTGGCT 0: 1
1: 0
2: 0
3: 13
4: 121
Right 1060406201 9:123374253-123374275 TCTCCCGGGAGCCCAGCGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060406201 Original CRISPR TCTCCCGGGAGCCCAGCGTG TGG Intronic
No off target data available for this crispr