ID: 1060406479

View in Genome Browser
Species Human (GRCh38)
Location 9:123375495-123375517
Sequence GGAAATACCTCTTGTGTGGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 150
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 138}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060406479_1060406487 -3 Left 1060406479 9:123375495-123375517 CCCCCCACACAAGAGGTATTTCC 0: 1
1: 0
2: 1
3: 10
4: 138
Right 1060406487 9:123375515-123375537 TCCACTGCAGGGAGAGCTTTGGG 0: 1
1: 0
2: 1
3: 15
4: 177
1060406479_1060406489 -2 Left 1060406479 9:123375495-123375517 CCCCCCACACAAGAGGTATTTCC 0: 1
1: 0
2: 1
3: 10
4: 138
Right 1060406489 9:123375516-123375538 CCACTGCAGGGAGAGCTTTGGGG 0: 1
1: 0
2: 1
3: 26
4: 273
1060406479_1060406490 -1 Left 1060406479 9:123375495-123375517 CCCCCCACACAAGAGGTATTTCC 0: 1
1: 0
2: 1
3: 10
4: 138
Right 1060406490 9:123375517-123375539 CACTGCAGGGAGAGCTTTGGGGG 0: 1
1: 0
2: 4
3: 29
4: 255
1060406479_1060406486 -4 Left 1060406479 9:123375495-123375517 CCCCCCACACAAGAGGTATTTCC 0: 1
1: 0
2: 1
3: 10
4: 138
Right 1060406486 9:123375514-123375536 TTCCACTGCAGGGAGAGCTTTGG 0: 1
1: 0
2: 1
3: 20
4: 224

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060406479 Original CRISPR GGAAATACCTCTTGTGTGGG GGG (reversed) Intronic
905959414 1:42031276-42031298 TGAAATACCTCCTGGGTGGCAGG + Intronic
906673392 1:47676446-47676468 GGAAAGAGCCCTTTTGTGGGGGG - Intergenic
909710535 1:78644541-78644563 GGAAACATCTTTTGTCTGGGAGG + Exonic
910011614 1:82470777-82470799 GGAAATACCTCTTGTGTTTCTGG + Intergenic
911181582 1:94865361-94865383 GGAAATTCCTGGTGTGTGTGAGG + Intronic
911567609 1:99482213-99482235 AGAAATAGATCTAGTGTGGGAGG + Intergenic
914029957 1:143949286-143949308 GGAGATTGCTCATGTGTGGGTGG - Intronic
914159492 1:145118664-145118686 GGAGATTGCTCATGTGTGGGTGG + Intergenic
915206630 1:154274835-154274857 GGAATTATCTCTTCTGTGGAAGG + Intronic
917578331 1:176348115-176348137 AGAAATAGCTGTTGGGTGGGTGG - Intergenic
919407149 1:197199993-197200015 TGAAATACCTCTTGTTTTAGAGG - Exonic
920465421 1:206180171-206180193 GGAGATTGCTCATGTGTGGGTGG - Intergenic
1062807651 10:436475-436497 GGAGAGAGCTCTGGTGTGGGCGG - Intronic
1067791148 10:49288725-49288747 GGAACTTCCTCTAGTGTGTGAGG + Intergenic
1070191662 10:74117175-74117197 TGAAATACCTCCTGTGTGCCAGG + Intronic
1070578346 10:77697845-77697867 GTATATACGTTTTGTGTGGGGGG + Intergenic
1071471521 10:85987270-85987292 GGTAAGGCCTCTTGTGAGGGAGG - Intronic
1072011531 10:91306447-91306469 GCAAGTACCTCTTTTCTGGGGGG - Intergenic
1072976667 10:100065058-100065080 GAAAATACCGCTTGTTTGTGAGG - Intronic
1075281138 10:121139436-121139458 AGAAATAACTCTTATTTGGGTGG - Intergenic
1078969132 11:16386320-16386342 GGAAAAACCTTTTTTGCGGGGGG + Intronic
1079132974 11:17760339-17760361 GGAAATTCCTCTTGTGTTTCAGG - Intronic
1082079058 11:47997734-47997756 GGGCATATCTCTTGTGTGGAAGG - Intronic
1083002249 11:59303246-59303268 GGAAATACCTCATCTATGGGAGG + Intergenic
1086083772 11:82933937-82933959 GGAAATATTTTTTGTGTGGTAGG - Exonic
1087201075 11:95345356-95345378 GGAAGTACGGCTTGGGTGGGAGG - Intergenic
1090610411 11:128466164-128466186 GGAAATATCTCCTGTGGAGGTGG - Intronic
1090618352 11:128537954-128537976 GGAAATACCTCTTATATTGAAGG - Intronic
1093771467 12:23022937-23022959 GGCAAAACCTATGGTGTGGGTGG - Intergenic
1099253181 12:80283984-80284006 ACAAATACCTAATGTGTGGGGGG - Intronic
1100043058 12:90343990-90344012 GGAAACATCTCTTGTGTAGATGG - Intergenic
1102632491 12:114293497-114293519 GGCAATACCTGTTGTGTGCTAGG + Intergenic
1105436109 13:20379751-20379773 AGAAATATCTCTGGGGTGGGAGG - Intergenic
1107626608 13:42292624-42292646 AGAAGTACCTGTTTTGTGGGCGG + Intronic
1108484936 13:50914103-50914125 AGAAATGCCTCTTGTTTTGGGGG + Intronic
1111386677 13:87537389-87537411 GGAATAACCTCCTGTGTGGCTGG - Intergenic
1115175958 14:30562156-30562178 TTAATTTCCTCTTGTGTGGGCGG + Intronic
1116379831 14:44251608-44251630 GGACATACCTCTGGTGGGGAAGG + Intergenic
1125585898 15:40819773-40819795 GGAAATAGCTATTGTGCTGGAGG + Intronic
1127393669 15:58526821-58526843 GGAAGACCGTCTTGTGTGGGTGG - Intronic
1128495125 15:68193655-68193677 GGGAATCCAGCTTGTGTGGGGGG + Exonic
1129241693 15:74255845-74255867 GGAAATAGCTCTTGGCTGGGAGG - Intronic
1133554715 16:6894549-6894571 AGAAATACTTCTTGTTTTGGGGG - Intronic
1134501518 16:14772516-14772538 GTAAATGACTCTTGTGTGAGAGG - Intronic
1134579044 16:15356363-15356385 GTAAATGACTCTTGTGTGAGAGG + Intergenic
1134723542 16:16401187-16401209 GTAAATGACTCTTGTGTGAGAGG - Intergenic
1134943887 16:18310683-18310705 GTAAATGACTCTTGTGTGAGAGG + Intergenic
1135374515 16:21934202-21934224 GTAAATGACTCTTGTGTGAGAGG - Intergenic
1135753809 16:25079804-25079826 GAAACTACCTCTTTTGTGGGTGG - Intergenic
1136154951 16:28376302-28376324 GTAAACAACTCTTGTGTGAGAGG + Intergenic
1136208140 16:28738956-28738978 GTAAACAACTCTTGTGTGAGAGG - Intergenic
1136264223 16:29105589-29105611 GTAAATGACTCTTGTGTGAGAGG - Intergenic
1138718835 16:59055022-59055044 CTAAATACCTCCTGTGTGGCAGG + Intergenic
1149431956 17:56601293-56601315 TGAAATTCCTCTTCTGTGCGTGG - Intergenic
1153129034 18:1833302-1833324 GTAAATAGGTCTTTTGTGGGAGG - Intergenic
1154107276 18:11533785-11533807 GGAAACAGCACTTGGGTGGGAGG + Intergenic
1154225796 18:12502810-12502832 GGAAATACCCCATGTGGGTGGGG + Intronic
1157330076 18:46697384-46697406 AGAAAGAACTCTTGTGGGGGAGG + Intronic
1157676418 18:49572011-49572033 TCAAATACCTCATGTGTGGCCGG + Intronic
1158516617 18:58135926-58135948 GGCCATACCCCTTGTGTGGTTGG + Intronic
1159060567 18:63510198-63510220 GGAAAGAACCCTGGTGTGGGAGG + Intergenic
1161590740 19:5128097-5128119 GGAGCTACCTGTTGTGTGTGAGG + Intronic
1164229582 19:23275634-23275656 GCAAATACATCTTCTGTGGGAGG - Intergenic
1164774763 19:30844309-30844331 GGGCAAGCCTCTTGTGTGGGGGG + Intergenic
1166621414 19:44304799-44304821 GGCAGAACCTCTTGCGTGGGAGG - Intronic
1168604081 19:57744241-57744263 GGAATAAACTCTTGTGTGTGTGG - Intronic
1168700272 19:58434561-58434583 GGAAATACCCCATGTGTGTAAGG - Exonic
926634611 2:15166156-15166178 GGGAACACCCCTTGTGTGGGAGG + Intergenic
931663779 2:64595361-64595383 GGAAATACCTCTATTCTGGGTGG + Intergenic
936510680 2:113142905-113142927 GTGGATACCTCTTGAGTGGGAGG - Intergenic
938949193 2:136241568-136241590 GGAAATACCTCATGTGTCCCAGG + Intergenic
941013277 2:160325583-160325605 GGAAATCCCCTTTGTCTGGGAGG - Intronic
943393790 2:187306573-187306595 GGAAATACCTCTTACATGGTTGG + Intergenic
948931911 2:241137434-241137456 GGAAAGAGCCCTTCTGTGGGTGG + Intronic
1169738075 20:8858976-8858998 TGACATACCTCTTGTTTGGAGGG + Intronic
1173373583 20:42461901-42461923 AGAAATACAGCTTGTGTGGAGGG + Intronic
1175483651 20:59329294-59329316 GGAAACCCCACTTGTGTGGCTGG - Intergenic
1175525471 20:59630677-59630699 GGAAGTACCACTGGGGTGGGCGG + Intronic
1177170019 21:17644688-17644710 GGAAAGGCCTTTTATGTGGGTGG + Intergenic
1178147233 21:29754268-29754290 CAAAATAACTCATGTGTGGGTGG + Intronic
1180172290 21:46065816-46065838 GGAGAAACCTCTTCTGCGGGTGG - Intergenic
1182042543 22:27249595-27249617 GGAAATAACCCTTGTGAGGATGG + Intergenic
949672610 3:6417153-6417175 TGAAATACCTACTGTGGGGGCGG + Intergenic
949867784 3:8560557-8560579 CGAAGTCCCTTTTGTGTGGGAGG + Intronic
951263999 3:20546521-20546543 GGAAATATCCCCTGTATGGGTGG - Intergenic
951334729 3:21406530-21406552 GCACAGACCGCTTGTGTGGGAGG - Intergenic
951774454 3:26294151-26294173 GGTAATATATATTGTGTGGGAGG - Intergenic
954229919 3:49208932-49208954 CTAAAGACCTCTTGTGTGGTAGG + Intronic
954882023 3:53843020-53843042 GAAAATTCCACCTGTGTGGGTGG + Intronic
955643670 3:61113578-61113600 GGAAATAACCCAGGTGTGGGGGG - Intronic
956631179 3:71317730-71317752 GAAAATAACAATTGTGTGGGGGG - Intronic
963280378 3:143378690-143378712 GAAACTTCCTGTTGTGTGGGAGG + Intronic
964406509 3:156354003-156354025 GACAATACCTCTACTGTGGGGGG - Intronic
968138538 3:196237154-196237176 ATAAATACCCCTTGTGGGGGTGG - Exonic
973776011 4:54242327-54242349 GGAGATACCTCTTGTGTCCATGG + Intronic
980706110 4:136497977-136497999 GAAATTACCTTTTGTGTAGGTGG - Intergenic
981102165 4:140841103-140841125 GGAAATACCTAAAGCGTGGGAGG + Intergenic
981359851 4:143833666-143833688 GGAAAGCTGTCTTGTGTGGGTGG + Intergenic
981370617 4:143954745-143954767 GGAAAGCTGTCTTGTGTGGGTGG + Intergenic
981717323 4:147764403-147764425 GGAAGTGCCTGTTCTGTGGGAGG + Intronic
983584017 4:169336973-169336995 GGATATATCTTTTGTATGGGTGG + Intergenic
983878994 4:172912094-172912116 ACAAATACCTCTTGTGTGGGGGG - Intronic
987404150 5:17507863-17507885 GGAAATTCCTGTTCTGTGTGTGG - Intergenic
987411757 5:17621573-17621595 GGAAATTCCTGTTCTGTGTGTGG - Intergenic
988167493 5:27613492-27613514 AGAAATACCTAATGTGTGCGGGG - Intergenic
989463827 5:41731164-41731186 AGGAATGCCTCTTGTGGGGGAGG - Exonic
990219212 5:53568527-53568549 GAAAATACCTCTTATGTGCATGG - Intronic
992497408 5:77307328-77307350 GGTAATACTTCTGGTTTGGGAGG - Intronic
993466083 5:88248972-88248994 GGAAATACCTAATGTGTCAGTGG - Intronic
995030007 5:107469673-107469695 GGAAACAGCTCTTGGGTGCGTGG - Intronic
996632438 5:125650412-125650434 GGAAATACATCTTGTGTTCATGG + Intergenic
997854520 5:137361428-137361450 GGAAATATCTGTTGAGTGAGTGG + Intronic
999156118 5:149458685-149458707 GGTGATACCTCATGTGTGGGAGG - Intergenic
1001678072 5:173534937-173534959 AGCAATACATCCTGTGTGGGTGG - Intergenic
1003435991 6:6088642-6088664 GTAAATACCTGTTGTGTGCCAGG - Intergenic
1004195884 6:13505075-13505097 GGAATTTCCTCTTGTTTAGGAGG + Intergenic
1005845542 6:29774276-29774298 GGAGTTATCTGTTGTGTGGGAGG - Intergenic
1005903090 6:30236146-30236168 GGAAAGACATCTTGTGTTGATGG - Intergenic
1007229227 6:40336812-40336834 GGGAATACCTCTGGCATGGGAGG + Intergenic
1008341029 6:50364459-50364481 GGAAATACTTCTTATTTTGGAGG + Intergenic
1008583847 6:52931083-52931105 GGAGATACCTCTGGTGAAGGGGG - Intergenic
1010150194 6:72722336-72722358 GGAAATAACTCTTGGCTGGAAGG - Intronic
1014343105 6:120233164-120233186 GGAACAACCTCTTGAATGGGAGG - Intergenic
1014869162 6:126569861-126569883 TGAAATACCTTTAGTGTGAGAGG + Intergenic
1021323126 7:19235897-19235919 GGATATCCCTCTTGTGCGTGAGG - Intergenic
1022640077 7:32173830-32173852 GGAACTCCCTCTTGTGTGTGAGG - Intronic
1023608386 7:41950298-41950320 GGAGATGCCTCTTGTGTCTGTGG - Intergenic
1024247890 7:47484186-47484208 GGAAAGACCTTTTGTGGGAGTGG + Intronic
1028187558 7:87805404-87805426 GGAAATAGATGCTGTGTGGGAGG + Intronic
1029473100 7:100766882-100766904 GGAAACACCACATCTGTGGGTGG + Intronic
1032086524 7:128886745-128886767 GGACACACCTCCTGGGTGGGGGG + Intronic
1032850059 7:135786609-135786631 AAAAATACCTCTTGATTGGGAGG - Intergenic
1036018281 8:4811519-4811541 GGAAATACCTCTTGTTTCTATGG - Intronic
1039155296 8:34548975-34548997 GGAAATACATCTTGTGTTTATGG - Intergenic
1039430149 8:37519546-37519568 GCAAATACCTCTTGGAAGGGTGG - Intergenic
1039960653 8:42244776-42244798 GGAAATAGCACTTTTGTGTGTGG - Intergenic
1041741826 8:61164703-61164725 GAGAAAACCTCGTGTGTGGGGGG - Intronic
1047415355 8:124660556-124660578 GGAACTTCCTCTTCTGTTGGAGG - Intronic
1051138845 9:13955375-13955397 GGACATTCCTCTTTTCTGGGTGG - Intergenic
1053440845 9:38115150-38115172 GGACATACCTCTGCTCTGGGGGG - Intergenic
1057767566 9:97935472-97935494 AGAACTTCCTGTTGTGTGGGGGG - Intronic
1057960355 9:99449913-99449935 AGACATACCTCCTGTGTGGGTGG - Intergenic
1058936205 9:109771904-109771926 GGTAATGCCTCTGGGGTGGGAGG - Intronic
1060406479 9:123375495-123375517 GGAAATACCTCTTGTGTGGGGGG - Intronic
1188021610 X:25164657-25164679 GGAAATACCTTAAGTGTGGAAGG + Intergenic
1192625117 X:72719177-72719199 GGACATATCTTTTGTGGGGGTGG - Intergenic
1192880041 X:75274053-75274075 GGCAGTACGTCTGGTGTGGGCGG + Intergenic
1195878125 X:109563539-109563561 GGAAATACCTCATGTGTCCTTGG + Intergenic
1200780175 Y:7207653-7207675 GGACATTCCTTTTGTGTTGGTGG + Intergenic
1201935296 Y:19405552-19405574 ATAAATACTTCTTGTGGGGGTGG - Intergenic