ID: 1060406805

View in Genome Browser
Species Human (GRCh38)
Location 9:123376899-123376921
Sequence CAGGAGGAGGAGGAGGAGGC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 8891
Summary {0: 1, 1: 35, 2: 509, 3: 2020, 4: 6326}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060406805_1060406822 26 Left 1060406805 9:123376899-123376921 CCTGCCTCCTCCTCCTCCTCCTG 0: 1
1: 35
2: 509
3: 2020
4: 6326
Right 1060406822 9:123376948-123376970 CCGAAAGCGCCGCCAGTCTGAGG 0: 1
1: 0
2: 0
3: 2
4: 24
1060406805_1060406812 -9 Left 1060406805 9:123376899-123376921 CCTGCCTCCTCCTCCTCCTCCTG 0: 1
1: 35
2: 509
3: 2020
4: 6326
Right 1060406812 9:123376913-123376935 CTCCTCCTGGGCCTCCTTTCAGG 0: 1
1: 0
2: 4
3: 31
4: 406
1060406805_1060406813 -8 Left 1060406805 9:123376899-123376921 CCTGCCTCCTCCTCCTCCTCCTG 0: 1
1: 35
2: 509
3: 2020
4: 6326
Right 1060406813 9:123376914-123376936 TCCTCCTGGGCCTCCTTTCAGGG 0: 1
1: 0
2: 3
3: 28
4: 278
1060406805_1060406816 -1 Left 1060406805 9:123376899-123376921 CCTGCCTCCTCCTCCTCCTCCTG 0: 1
1: 35
2: 509
3: 2020
4: 6326
Right 1060406816 9:123376921-123376943 GGGCCTCCTTTCAGGGATCCTGG 0: 1
1: 0
2: 4
3: 17
4: 158
1060406805_1060406823 27 Left 1060406805 9:123376899-123376921 CCTGCCTCCTCCTCCTCCTCCTG 0: 1
1: 35
2: 509
3: 2020
4: 6326
Right 1060406823 9:123376949-123376971 CGAAAGCGCCGCCAGTCTGAGGG 0: 1
1: 0
2: 0
3: 2
4: 12

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060406805 Original CRISPR CAGGAGGAGGAGGAGGAGGC AGG (reversed) Exonic
Too many off-targets to display for this crispr