ID: 1060407042

View in Genome Browser
Species Human (GRCh38)
Location 9:123377957-123377979
Sequence GGACCGTCTGGGTGTCCTTC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 82
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 77}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060407039_1060407042 -9 Left 1060407039 9:123377943-123377965 CCGTCTGATGGGAAGGACCGTCT 0: 1
1: 0
2: 0
3: 4
4: 83
Right 1060407042 9:123377957-123377979 GGACCGTCTGGGTGTCCTTCTGG 0: 1
1: 0
2: 0
3: 4
4: 77

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060407042 Original CRISPR GGACCGTCTGGGTGTCCTTC TGG Exonic
900216058 1:1482282-1482304 AGACCGTCTTGGAGTCCATCAGG + Exonic
900223179 1:1520285-1520307 AGACCGTCTTGGAGTCCATCAGG + Exonic
900523176 1:3115972-3115994 GGGCCGCCTGGGAGTCCTCCCGG - Intronic
902213750 1:14922256-14922278 GGACTGTCTGAGTTACCTTCAGG - Intronic
903867707 1:26411014-26411036 GCACCGTCTTGGGGTCCTTTGGG - Intronic
905122275 1:35691291-35691313 GGACTGGCTGGGTGTCCCCCAGG - Intergenic
909047669 1:70729501-70729523 AGACTGTCTGGGTTTCATTCTGG - Intergenic
912665585 1:111576652-111576674 GGAACGTGTGGGTGTGCTTATGG + Intronic
918236092 1:182582081-182582103 GGACTGTCTGAGTGACCTGCTGG - Exonic
919740210 1:200976823-200976845 TGGCCGTCTGGGTGACCGTCAGG + Exonic
922674654 1:227542885-227542907 AGACTTTCTGGGTGTCCTCCTGG + Intergenic
1067173665 10:43927328-43927350 GGACTGTCTGGCTGTGCTGCTGG - Intergenic
1073253846 10:102138591-102138613 GGACCTTCTGGTTGTTTTTCTGG + Intronic
1074187659 10:111110950-111110972 GGACCAACTGGGTGGCCATCTGG - Intergenic
1084199331 11:67544897-67544919 GGAACTTCTGGGTGTTTTTCTGG + Intergenic
1084663138 11:70558757-70558779 GGGCCGTCAGTGTGTCTTTCTGG - Intronic
1085535198 11:77213373-77213395 GGACCCTCTGGGTGTGCAGCTGG - Intronic
1087693856 11:101353294-101353316 GAACAGTCTGGGTGACCTCCAGG - Intergenic
1092109351 12:5948012-5948034 GGACCGGCTGGGTTTCTATCAGG - Intergenic
1097856779 12:64471912-64471934 GGTCCGTCTTTGTCTCCTTCTGG + Intronic
1107134020 13:36924620-36924642 GGATAGTCTGTGTGTCCCTCAGG - Intergenic
1112045803 13:95596511-95596533 GGACCATCTGGATGGCCTTTGGG - Intronic
1113936804 13:113999232-113999254 GGACCGTCTGGAATTCCTTTTGG - Intronic
1122297184 14:100712218-100712240 GGAGCATCTGGGTGTCCCACAGG + Intergenic
1122320787 14:100854573-100854595 GGACCTCCTGGGTGTGCTTGTGG + Intergenic
1124657598 15:31521825-31521847 GGACCGTTTGGGGGACCCTCTGG - Intronic
1128062384 15:64743149-64743171 GGACGGGCTGGGTGTCCCGCAGG + Intronic
1130767018 15:86880949-86880971 GGGGCGTCTGTGTGTTCTTCAGG + Intronic
1134325884 16:13207232-13207254 GGAGCGACTGGGTGTCATACTGG - Intronic
1135417999 16:22283786-22283808 GAAACGTCAGGGTGTTCTTCTGG + Intronic
1137367445 16:47872902-47872924 GGTGGGTCTGGGTGTCCTGCTGG + Intergenic
1142887474 17:2921738-2921760 GGACCGTTAAGGTGTCCTTAAGG + Intronic
1144676703 17:17166670-17166692 GGGCCGTCTGGGTGCCCCGCAGG - Intronic
1146183356 17:30710363-30710385 GGTCCGTCTGGGTGTCAAGCCGG + Intergenic
1147193616 17:38750622-38750644 GGACAGGCTGTGTGTCCTTCAGG - Exonic
1152901060 17:82941432-82941454 CAACCGTCTGTGTGACCTTCTGG + Exonic
1154323447 18:13372579-13372601 AGGCCGTCTGGGTGTCCTGGAGG + Intronic
1157564504 18:48670708-48670730 GGACCTTCTCGATGTCATTCAGG - Exonic
1162975434 19:14205397-14205419 GGTCCGTCTGGGTGTCCAGCCGG - Intronic
1163418676 19:17202210-17202232 GGACCAGGTTGGTGTCCTTCTGG - Exonic
1168254356 19:55157657-55157679 GGGCCGCCCGGGTGACCTTCAGG + Exonic
926198970 2:10780008-10780030 AGACCCTCTGTGTGACCTTCCGG + Intronic
927135541 2:20093815-20093837 AGACCGTGTGGATGTCCTGCAGG - Intergenic
932600734 2:73123415-73123437 ATACCTTCTGGGTCTCCTTCAGG + Intronic
937662899 2:124451638-124451660 GGAGGGTCTGTGTGTCCTCCGGG - Intronic
937990511 2:127659513-127659535 GGACAGGCTTGGTTTCCTTCCGG + Intronic
946178010 2:217933653-217933675 GGGAGGTCTGGGTGTGCTTCAGG - Intronic
947852557 2:233300051-233300073 TGACCATCCGGGTGTACTTCTGG - Intergenic
1170241034 20:14166588-14166610 GGACTGTCTGGGAGACCTCCAGG - Intronic
1172804587 20:37602655-37602677 GGACCATCTTGGTTTTCTTCTGG - Intergenic
1173807829 20:45937518-45937540 GGACCCTGTGGGGGTCCATCCGG + Exonic
1175693442 20:61083127-61083149 GGGCCGTTTGGGTGCTCTTCTGG - Intergenic
1179294789 21:40052024-40052046 GGACCGTGTGAGTGACCGTCAGG + Exonic
1179635179 21:42704172-42704194 GGCCAGGCTGGGTGTCCCTCCGG + Intronic
1180865446 22:19116253-19116275 GGACCTTCTGGGCATCCTCCTGG - Intronic
1184417236 22:44359431-44359453 GCATCCTCTGGGTGTCCATCAGG + Intergenic
1184762083 22:46550492-46550514 GGTCCGTCTGGGTGGGCTCCTGG + Intergenic
1185199346 22:49492090-49492112 GAACCGTCTGAGTGTACTTTGGG - Intronic
950026891 3:9826278-9826300 GGACCTTATGGATATCCTTCTGG - Intronic
950503647 3:13379643-13379665 GGCCGGGCTGGGTCTCCTTCGGG + Exonic
955979050 3:64506291-64506313 TGCCTGCCTGGGTGTCCTTCTGG - Intergenic
960592245 3:119377669-119377691 GGAACCACTGTGTGTCCTTCAGG - Intronic
966412936 3:179661909-179661931 GCAGCATCTGAGTGTCCTTCTGG + Intronic
968453444 4:685888-685910 GAACCCTCTGGGCGTCCTTGTGG - Exonic
968985486 4:3872310-3872332 GGAGCGTCTGGGGGCCCTGCCGG + Intergenic
971597835 4:28554378-28554400 GGACCTACTGGGTGTGCTTTTGG - Intergenic
971819900 4:31538812-31538834 GGACCGTTTGGCTTTGCTTCTGG + Intergenic
1006990802 6:38213134-38213156 AGACCGTCTGGTGATCCTTCTGG - Intronic
1018068138 6:160137920-160137942 GCACCTTCTGGGTGGCCTGCTGG + Intronic
1019165238 6:170094137-170094159 GGACTGGCTGGGTGACCCTCAGG + Intergenic
1022472391 7:30689692-30689714 GGAACTGATGGGTGTCCTTCAGG + Intronic
1026910175 7:74086993-74087015 GGTCCTACTGGGTGACCTTCAGG - Intronic
1028567023 7:92245507-92245529 GGGACCTCTCGGTGTCCTTCGGG - Exonic
1033494662 7:141881911-141881933 GGACCTTGTGTGAGTCCTTCAGG + Intergenic
1036712054 8:11086043-11086065 GGACCGTGAGAGTGTCCTCCGGG - Intronic
1037063985 8:14553138-14553160 CTACTGTCTGGGTGTCCTTCAGG - Intronic
1049794306 8:144489438-144489460 GGAGGGTCTGAGTGTCCTCCAGG - Intronic
1055308138 9:74952009-74952031 GGACTCTCGGGGTGTGCTTCTGG + Intronic
1059224929 9:112663155-112663177 GGACCCATAGGGTGTCCTTCAGG + Exonic
1060407042 9:123377957-123377979 GGACCGTCTGGGTGTCCTTCTGG + Exonic
1062398639 9:136362941-136362963 GGTACTTCTGGGTGGCCTTCTGG + Intronic
1195726875 X:107926818-107926840 GAAGCGTCTGGGTGTCCTCCTGG + Exonic