ID: 1060407205

View in Genome Browser
Species Human (GRCh38)
Location 9:123378732-123378754
Sequence CCTAACATGCAGATGAAAGC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 147
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 135}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060407203_1060407205 -2 Left 1060407203 9:123378711-123378733 CCTAGGATATTTTATGTGGAACC 0: 1
1: 0
2: 0
3: 7
4: 114
Right 1060407205 9:123378732-123378754 CCTAACATGCAGATGAAAGCTGG 0: 1
1: 0
2: 0
3: 11
4: 135
1060407200_1060407205 16 Left 1060407200 9:123378693-123378715 CCTGTGTCAGCTGTAACTCCTAG 0: 1
1: 0
2: 1
3: 10
4: 99
Right 1060407205 9:123378732-123378754 CCTAACATGCAGATGAAAGCTGG 0: 1
1: 0
2: 0
3: 11
4: 135

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060407205 Original CRISPR CCTAACATGCAGATGAAAGC TGG Exonic
902076021 1:13786657-13786679 CCTAACATTCAGCTGATTGCCGG + Intronic
903545501 1:24121202-24121224 CCTAACATGCAGCTTCCAGCTGG + Exonic
905504258 1:38464597-38464619 ACTATCATGCAGAAGAGAGCAGG - Intergenic
908098248 1:60763212-60763234 CCTTAGATGCAAATGAAACCAGG - Intergenic
910260974 1:85293627-85293649 CCTCACATGGAGGAGAAAGCAGG - Intergenic
915605695 1:156948760-156948782 CCTAACAGGAAGATGAAATCTGG + Intronic
917164038 1:172091490-172091512 GGAACCATGCAGATGAAAGCGGG + Intronic
918608279 1:186456032-186456054 CCTAACATGCAGAGGAATACTGG - Intronic
921542573 1:216434092-216434114 TCTATAATGCAGATGATAGCTGG + Intergenic
921798307 1:219373173-219373195 CTGAACATACATATGAAAGCAGG + Intergenic
923006635 1:230055090-230055112 TCTGACATGCAGCTGTAAGCTGG - Intergenic
1068445295 10:57114336-57114358 CCTAACATGTAGATGTCAGGAGG + Intergenic
1069228177 10:65970383-65970405 CCTATCATGAAGTTGTAAGCTGG - Intronic
1070362831 10:75707507-75707529 TAGAAAATGCAGATGAAAGCCGG + Intronic
1077762597 11:5119293-5119315 CCAAGCATGCAAATGGAAGCTGG + Intergenic
1078475544 11:11626113-11626135 TCTAACATGCAAATGAATGGAGG + Intergenic
1078852990 11:15180724-15180746 ACTAATATGCAGATGAATGGAGG - Intronic
1086938379 11:92768663-92768685 GCTAACATACAGAGGAAAGAGGG + Intronic
1089127237 11:116185177-116185199 CCTATCAGGCAGAAGCAAGCTGG - Intergenic
1091633988 12:2183584-2183606 CGTGACATTCTGATGAAAGCCGG - Intronic
1092727902 12:11501959-11501981 CCTAACAAGAAGATTAAAACAGG - Intergenic
1093027293 12:14256586-14256608 CGTAAAATGCACATGAAACCAGG + Intergenic
1097988705 12:65811419-65811441 CCTAACAGGCAGGGGAAAGAAGG + Intergenic
1101349479 12:103915536-103915558 CCCAGCATGCAGATGAAAAAGGG + Intergenic
1102993219 12:117329516-117329538 CCTAAGATGCAAATGGAAGGGGG + Intronic
1106392557 13:29349003-29349025 CATCAAATGCATATGAAAGCCGG - Intronic
1110237937 13:73235810-73235832 CATAAATTCCAGATGAAAGCAGG - Intergenic
1111217037 13:85157815-85157837 CCTAACATTATGATGAAAGAGGG - Intergenic
1114907442 14:27148275-27148297 ACTAACATGAAGTTGACAGCTGG + Intergenic
1117410128 14:55442850-55442872 CCTCACAAGAAGATGAAATCTGG + Intronic
1121422390 14:93824779-93824801 CCTGACAAGCAGATGGAAGTGGG - Intergenic
1125058732 15:35393088-35393110 TCTAAAATGCAGATGCAATCAGG - Intronic
1126342258 15:47654094-47654116 CCTAAAATGAAGAAGAAAGAAGG + Intronic
1127173432 15:56328077-56328099 CCTTACAAGCAGAAGGAAGCGGG - Intronic
1130678798 15:85978375-85978397 CTTAACATGCAGAAGAGAGGTGG - Intergenic
1132979815 16:2731573-2731595 CCAGACCTGCAGATGAAAGAAGG + Intergenic
1133496487 16:6323030-6323052 CCTTATATGCAGAGGGAAGCTGG - Intronic
1133991548 16:10711237-10711259 CCTAATATGCAGTTGAAAAGAGG - Intergenic
1134016573 16:10892515-10892537 CATGACATGCAGATGAAGGCTGG - Intronic
1134626384 16:15725649-15725671 TCTCACATGCAGTTGAGAGCAGG - Exonic
1138920868 16:61527239-61527261 ACTGACAAGCAGATGAAACCTGG - Intergenic
1138948983 16:61887572-61887594 CCTTACATGAAGAGGAAATCCGG - Intronic
1139253008 16:65514771-65514793 CATAATATGAAGATGAAAGGTGG - Intergenic
1139973712 16:70792286-70792308 CCCAACCTGTAGATGAAAGGAGG - Intronic
1141257942 16:82420771-82420793 TATAGCATGCAGATGACAGCAGG + Intergenic
1143730279 17:8878526-8878548 CCTACCATGCAGCTGAGAGGAGG - Intergenic
1146504545 17:33393711-33393733 CCTAAGATTCAGATGGAACCAGG + Intronic
1146640422 17:34536556-34536578 GCTAGCATGCAGATGCCAGCTGG - Intergenic
1148998939 17:51737174-51737196 CCAACCATGCAACTGAAAGCAGG + Intronic
1149399656 17:56282620-56282642 TCAAATATGCAGATGAAAACTGG - Intronic
1203158191 17_GL000205v2_random:24611-24633 ACAAACATTCAGATTAAAGCAGG + Intergenic
1155466437 18:26140742-26140764 TCTATGATGCAGATGAAAGCGGG - Intronic
1156358193 18:36360884-36360906 TCTAAAATGCAGAGGAAACCTGG - Intronic
1157648899 18:49306976-49306998 CATAACAAGCAGATGAGAGTGGG - Intronic
1159677109 18:71299010-71299032 CATCTCATGGAGATGAAAGCGGG + Intergenic
1167158194 19:47751803-47751825 TCTAAAATGCAGATGAGGGCCGG + Intronic
925896638 2:8477495-8477517 CCTAACATGCAGTGGACACCAGG + Intergenic
926391725 2:12400563-12400585 CATAAGATGCACATGAAATCAGG - Intergenic
929019301 2:37535817-37535839 TCTAACATGTATATGAAGGCTGG + Intergenic
929749282 2:44693128-44693150 ACTAATATCCAGATGAGAGCTGG - Intronic
931080610 2:58765695-58765717 CCTAATATGTAGATGAAAAGGGG + Intergenic
931970484 2:67580198-67580220 ACTTACATGCATATGCAAGCGGG - Intergenic
938131995 2:128724701-128724723 CCGAACATGCAGATGATGGATGG - Intergenic
940718755 2:157258497-157258519 CCTAACAAGCAGAAGACAGACGG + Exonic
941337203 2:164261230-164261252 ACTAACATGAAAATGAAAGAGGG + Intergenic
942032453 2:171976573-171976595 CATAACAAGCAGAGGAAAGATGG + Intronic
945556280 2:211280440-211280462 CTTATCATGAAGAAGAAAGCTGG + Intergenic
946539959 2:220673346-220673368 CTCAAAATGCAGAGGAAAGCAGG + Intergenic
948080384 2:235200682-235200704 CCTTACATGCAGAAAAAGGCAGG - Intergenic
948116244 2:235495606-235495628 CCTGACATGCAGAGGGAAGCGGG - Intronic
1169730779 20:8783686-8783708 ACTAATATGCAGAGAAAAGCAGG - Intronic
1173683219 20:44902266-44902288 CCTAACTTTCAGACCAAAGCAGG - Intronic
1174340430 20:49891770-49891792 CCCACCATGCAGGTGGAAGCAGG - Exonic
1174915128 20:54645650-54645672 CATAAGATGCAGATGATGGCCGG + Intronic
1175529702 20:59666069-59666091 CACAACAGGCAGATGGAAGCTGG - Intronic
1176957102 21:15118239-15118261 CCTAGCTAGAAGATGAAAGCAGG + Intergenic
1178722455 21:35022116-35022138 GCTAACATGTAGCTGAGAGCGGG + Intronic
1178815543 21:35925784-35925806 CCTGTCAGGCAGATCAAAGCAGG - Intronic
1180011036 21:45051698-45051720 CCTCACATGCAGAGGGTAGCTGG - Intergenic
1181303894 22:21903180-21903202 CCTAACATGCAGAGCAAATAGGG - Intergenic
951764209 3:26179192-26179214 CATGACAGACAGATGAAAGCAGG + Intergenic
952499592 3:33948101-33948123 CATCACATGTACATGAAAGCTGG + Intergenic
957611671 3:82474499-82474521 CCTAAAACACAGATGAAAGGTGG + Intergenic
962963966 3:140336647-140336669 TCTGACAGGCTGATGAAAGCTGG - Intronic
964701901 3:159577155-159577177 CCTAACATTTAGCTAAAAGCAGG - Intronic
971683598 4:29734484-29734506 TCTGTCATGCAGATGAAACCAGG - Intergenic
973998902 4:56490162-56490184 CCACACATGTAGAGGAAAGCAGG - Intronic
975103329 4:70539567-70539589 CCCAAAATGCAGAGGAAAGAAGG - Intergenic
975893665 4:79059911-79059933 CCTACCTTGGAGATGAAGGCTGG - Intergenic
982318949 4:154059297-154059319 TGTAACATGCAGATGATAACAGG - Intergenic
982512294 4:156298169-156298191 TCTAACATGCAGATCAGAGGTGG - Intergenic
983512347 4:168622170-168622192 CCTCACATGCAGACAAAATCTGG + Intronic
983742452 4:171152409-171152431 CCAAACATGTAGATGGAAACTGG + Intergenic
987600643 5:20065085-20065107 CCTAACACTCTGATGAAAGCTGG - Intronic
988303947 5:29470374-29470396 CCTAACATGCAGCGGAAACCTGG - Intergenic
988406175 5:30825938-30825960 CCTATCATGAAGTTGATAGCTGG + Intergenic
988874824 5:35432288-35432310 CCAAACCTTCAGTTGAAAGCTGG - Intergenic
993125065 5:83823929-83823951 CCTCAAATGAAGATGAAAGGAGG - Intergenic
993714484 5:91261959-91261981 ACTAATATGAAGAAGAAAGCAGG + Intergenic
999072130 5:148755032-148755054 CCTGACATTCATATGAAACCAGG - Intergenic
999886242 5:155926064-155926086 CCTCACAAGCAGATGAAAGTTGG - Intronic
1002421123 5:179149584-179149606 CCTAACCTGGAAATGGAAGCTGG + Intronic
1003351507 6:5321864-5321886 CATAACACCCATATGAAAGCAGG - Intronic
1009046616 6:58242776-58242798 CCTAACATCCAGAGGAAAAGAGG + Intergenic
1009048100 6:58251643-58251665 CCTAACATCCAGAAGAAAAGAGG + Intergenic
1009222426 6:60997088-60997110 CCTAACATCCAGAGGAAAAGAGG + Intergenic
1009223985 6:61006424-61006446 CCTAACATCCAGAAGAAAAGAGG + Intergenic
1009545540 6:65014976-65014998 GGTGACATGAAGATGAAAGCTGG + Intronic
1010526746 6:76909390-76909412 AGTAATATGCAGAAGAAAGCTGG + Intergenic
1012493177 6:99805548-99805570 TCTAACAGTGAGATGAAAGCAGG + Intergenic
1015187703 6:130437022-130437044 CTGAACTTGTAGATGAAAGCAGG - Intronic
1020939043 7:14507782-14507804 CCAAACATGCAGATGGCAGGAGG + Intronic
1024879101 7:54065760-54065782 TCTAACATGGCAATGAAAGCTGG + Intergenic
1026890721 7:73980342-73980364 CAGAACAGGGAGATGAAAGCTGG + Intergenic
1028469063 7:91185028-91185050 CCTAAAATACAGATGACAGCTGG - Intronic
1031480195 7:122269218-122269240 CCTAACATGGAGATGAGAGTGGG - Intergenic
1036949281 8:13125607-13125629 CCTAACCTGGGGATGAGAGCTGG - Intronic
1039139928 8:34375279-34375301 CCTAACATGCAGTGGAAATCAGG - Intergenic
1044602535 8:94020134-94020156 GCTAACAAGCAGCTGAAAGGCGG + Intergenic
1047762241 8:127962889-127962911 CCTAAAATGCAGATGAGGCCAGG - Intergenic
1051286145 9:15498827-15498849 CTTAACATGCACACAAAAGCAGG + Intronic
1056244041 9:84676641-84676663 CCTAGCATCCAAATGAATGCTGG + Intronic
1056724056 9:89096805-89096827 CCTAAAATGCACAGGACAGCTGG + Intronic
1058629972 9:106976315-106976337 TCTAACAAGCAGTTGAAATCTGG - Intronic
1059278103 9:113111997-113112019 ACTATCAGGAAGATGAAAGCAGG + Intergenic
1059638639 9:116194352-116194374 ACCAGCATGCAGATGAAAGGGGG + Intronic
1060112621 9:120917592-120917614 CCTAACATGGAAATGTCAGCAGG + Intronic
1060407205 9:123378732-123378754 CCTAACATGCAGATGAAAGCTGG + Exonic
1203496489 Un_GL000224v1:156386-156408 ACAAACATTCAGATGACAGCAGG + Intergenic
1203496758 Un_GL000224v1:158981-159003 ACAAACATTCAGATGACAGCAGG + Intergenic
1203496890 Un_GL000224v1:160220-160242 ACAAACATTCAGATGACAGCAGG + Intergenic
1203497304 Un_GL000224v1:164143-164165 ACAAACATTCAGATGACAGCAGG + Intergenic
1203509113 Un_KI270741v1:98308-98330 ACAAACATTCAGATGACAGCAGG + Intergenic
1203509381 Un_KI270741v1:100903-100925 ACAAACATTCAGATGACAGCAGG + Intergenic
1203509514 Un_KI270741v1:102142-102164 ACAAACATTCAGATGACAGCAGG + Intergenic
1203509863 Un_KI270741v1:106199-106221 ACAAACATTCAGATGACAGCAGG + Intergenic
1186423660 X:9445973-9445995 CCCAGCCAGCAGATGAAAGCAGG + Intergenic
1186896673 X:14010848-14010870 CCTAATATGCAAATGAATGGGGG + Intronic
1189012534 X:37060822-37060844 CCAAACATCCAGATGAAGGTGGG + Intergenic
1189030549 X:37445028-37445050 CCAAACATCCAGATGAAGGTGGG - Intronic
1190118102 X:47638889-47638911 CCTTACCTGCAGAGGCAAGCCGG + Exonic
1192410062 X:70926105-70926127 CTTATGATGCAGATGACAGCTGG - Exonic
1194322487 X:92467446-92467468 CCTAAAATGCAGATGTGATCAGG + Intronic
1195746515 X:108124058-108124080 CCTCACAGGCAGAAGAAATCAGG - Intronic
1197844962 X:130791733-130791755 CCTAAGATGCAGAAGATACCAGG - Intronic
1199207736 X:145168383-145168405 CTTATCTTGAAGATGAAAGCAGG - Intergenic
1200630639 Y:5580922-5580944 CCTAAAATGCAGATGTGATCAGG + Intronic