ID: 1060407646

View in Genome Browser
Species Human (GRCh38)
Location 9:123380823-123380845
Sequence CAGAATCAACTGAAGTTTTG GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 284
Summary {0: 1, 1: 0, 2: 2, 3: 29, 4: 252}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060407633_1060407646 4 Left 1060407633 9:123380796-123380818 CCCCCTGGTCCCCAGATCCTCCC 0: 1
1: 0
2: 4
3: 70
4: 579
Right 1060407646 9:123380823-123380845 CAGAATCAACTGAAGTTTTGGGG 0: 1
1: 0
2: 2
3: 29
4: 252
1060407640_1060407646 -7 Left 1060407640 9:123380807-123380829 CCAGATCCTCCCAGGTCAGAATC 0: 1
1: 0
2: 1
3: 16
4: 242
Right 1060407646 9:123380823-123380845 CAGAATCAACTGAAGTTTTGGGG 0: 1
1: 0
2: 2
3: 29
4: 252
1060407636_1060407646 1 Left 1060407636 9:123380799-123380821 CCTGGTCCCCAGATCCTCCCAGG 0: 1
1: 0
2: 3
3: 50
4: 398
Right 1060407646 9:123380823-123380845 CAGAATCAACTGAAGTTTTGGGG 0: 1
1: 0
2: 2
3: 29
4: 252
1060407634_1060407646 3 Left 1060407634 9:123380797-123380819 CCCCTGGTCCCCAGATCCTCCCA 0: 1
1: 0
2: 4
3: 42
4: 432
Right 1060407646 9:123380823-123380845 CAGAATCAACTGAAGTTTTGGGG 0: 1
1: 0
2: 2
3: 29
4: 252
1060407639_1060407646 -6 Left 1060407639 9:123380806-123380828 CCCAGATCCTCCCAGGTCAGAAT 0: 1
1: 0
2: 0
3: 19
4: 185
Right 1060407646 9:123380823-123380845 CAGAATCAACTGAAGTTTTGGGG 0: 1
1: 0
2: 2
3: 29
4: 252
1060407632_1060407646 10 Left 1060407632 9:123380790-123380812 CCAAGACCCCCTGGTCCCCAGAT 0: 1
1: 0
2: 2
3: 23
4: 269
Right 1060407646 9:123380823-123380845 CAGAATCAACTGAAGTTTTGGGG 0: 1
1: 0
2: 2
3: 29
4: 252
1060407638_1060407646 -5 Left 1060407638 9:123380805-123380827 CCCCAGATCCTCCCAGGTCAGAA 0: 1
1: 0
2: 3
3: 26
4: 249
Right 1060407646 9:123380823-123380845 CAGAATCAACTGAAGTTTTGGGG 0: 1
1: 0
2: 2
3: 29
4: 252
1060407631_1060407646 11 Left 1060407631 9:123380789-123380811 CCCAAGACCCCCTGGTCCCCAGA 0: 1
1: 0
2: 2
3: 49
4: 1056
Right 1060407646 9:123380823-123380845 CAGAATCAACTGAAGTTTTGGGG 0: 1
1: 0
2: 2
3: 29
4: 252
1060407635_1060407646 2 Left 1060407635 9:123380798-123380820 CCCTGGTCCCCAGATCCTCCCAG 0: 1
1: 0
2: 4
3: 47
4: 432
Right 1060407646 9:123380823-123380845 CAGAATCAACTGAAGTTTTGGGG 0: 1
1: 0
2: 2
3: 29
4: 252

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060407646 Original CRISPR CAGAATCAACTGAAGTTTTG GGG Exonic
902882625 1:19382776-19382798 CACAGTCAACTGGAGTTTTTAGG + Intronic
903269086 1:22176692-22176714 CAGACTCTACTGAAGGTTTGGGG - Intergenic
903707609 1:25298423-25298445 CAGGCTGAATTGAAGTTTTGAGG - Intronic
903719632 1:25394931-25394953 CAGGCTGAATTGAAGTTTTGAGG + Intronic
906061358 1:42950991-42951013 GAGAATTAACTGAAGCTTAGAGG - Intronic
906754738 1:48299971-48299993 AAGGATCAACTGTAGTTTTGAGG + Intronic
907510681 1:54956081-54956103 CAGAAGCAACTGCAGGTTTCTGG + Intergenic
907772798 1:57482746-57482768 AAGAATCCAGTGAAGTATTGAGG - Intronic
907872294 1:58454320-58454342 CAGGAGCAACTGCAGTTTGGGGG + Intronic
908643960 1:66256521-66256543 CAGATTAAATTGAAGTTTGGAGG + Intronic
908948841 1:69534975-69534997 CAGAATCAATTGAAGTTTTAAGG - Intergenic
909182134 1:72438131-72438153 CAGCATCAATTGAAATTTTATGG + Intergenic
910659866 1:89660305-89660327 CAGAAGAAACAGATGTTTTGGGG + Intronic
911761074 1:101618071-101618093 AAGAATGAACTGAAGTTATCAGG + Intergenic
911779968 1:101864102-101864124 CAGTAACAACTGAAGTTGTTAGG - Intronic
912322903 1:108731091-108731113 CAGAAGCCTCTGAAGCTTTGAGG - Intronic
913706050 1:121424015-121424037 CATAATCAGATGAAGTTCTGTGG - Intergenic
917247182 1:173016695-173016717 CAGAATGAACTAAAGTGTGGTGG + Intergenic
918361400 1:183762594-183762616 CATAATAAATTGAAGGTTTGTGG - Intronic
921266709 1:213426434-213426456 CAGACTCAAGTGAGTTTTTGCGG + Intergenic
921453611 1:215340313-215340335 CAGAAGCAACAGAAAGTTTGAGG - Intergenic
921593159 1:217026670-217026692 AATATTCAACTGAACTTTTGGGG - Intronic
921637264 1:217511419-217511441 CAGAATCAGCAGTAGTTTTAAGG - Intronic
922080344 1:222289694-222289716 CAGACTAACCTGATGTTTTGTGG - Intergenic
1065088989 10:22210692-22210714 CAGAACCAAATCAAGTTTTGGGG + Intergenic
1065824361 10:29556537-29556559 CCAATTCAACTGAAGTTTTAAGG - Intronic
1065961907 10:30740456-30740478 CAGGAGCAAGTGCAGTTTTGTGG + Intergenic
1067898049 10:50206405-50206427 CATAATTAACTGCAGATTTGTGG + Intronic
1067962732 10:50874636-50874658 CAGATTACAGTGAAGTTTTGGGG - Intronic
1068654648 10:59562255-59562277 CAAAGGCAACTGAAGTTTTCCGG - Intergenic
1068844404 10:61655637-61655659 CAGAATCTACTGGAATTCTGTGG + Intergenic
1069984713 10:72275225-72275247 CAGAGACGACTGAACTTTTGGGG + Exonic
1071436315 10:85651073-85651095 CAGAATCACCTGGAGGGTTGTGG - Intronic
1072313925 10:94183534-94183556 CAGTGTCAACTGAAGTGTTCAGG + Intronic
1072618551 10:97065308-97065330 CAGAGTAAACTGAAGCTGTGAGG + Intronic
1072809405 10:98447185-98447207 CCTAATGAACTGAAGTTCTGGGG + Intergenic
1074272379 10:111967324-111967346 CACAAACAAAAGAAGTTTTGTGG + Intergenic
1075611196 10:123856080-123856102 AAGAAACAGCTGATGTTTTGAGG - Intronic
1077979076 11:7281014-7281036 AAGAATCAACTTAAATTTTCAGG - Intronic
1078054521 11:7996560-7996582 AAGAATTTTCTGAAGTTTTGGGG - Exonic
1078080057 11:8197588-8197610 CAGAATCAGTTTGAGTTTTGGGG + Intergenic
1078162764 11:8856067-8856089 CTGAACCAACTGAAGGTTTATGG + Intronic
1078736771 11:14027408-14027430 CAGAAGCAACTGAAGCTCAGAGG - Intronic
1078935055 11:15942489-15942511 GAGAATCAAATGAGGTTTGGAGG + Intergenic
1079018760 11:16891835-16891857 CTGAAGCAACTGGAGTTTTCAGG + Intronic
1079123708 11:17703436-17703458 AAGAATAAACTGAAATTTTTAGG - Intergenic
1085447431 11:76610161-76610183 CAGAGGCAACTGACTTTTTGGGG + Intergenic
1087150741 11:94857294-94857316 CAGAATCATTTGAAGTTTTAGGG + Intronic
1088385335 11:109248035-109248057 CAGTATTACCTGCAGTTTTGGGG + Intergenic
1088480098 11:110288768-110288790 CAAAATCAACAGACATTTTGAGG - Intronic
1089039220 11:115430346-115430368 AAGTAACAAATGAAGTTTTGAGG - Intronic
1090427931 11:126622716-126622738 TAGTCTCCACTGAAGTTTTGTGG - Intronic
1092392058 12:8089459-8089481 CAGAATCAACTGAACCTGGGAGG - Intronic
1093588200 12:20868273-20868295 CAGATTCAAGTTAAGTTTTTGGG + Intronic
1094293384 12:28876973-28876995 CAGTCTCAACTGCAGCTTTGTGG - Intergenic
1094404545 12:30101734-30101756 GAGAAACAAGAGAAGTTTTGAGG - Intergenic
1096209275 12:49750684-49750706 CAGAATTAACAAAAGTTCTGAGG + Intronic
1096896553 12:54826459-54826481 CAGACTCAACTGGTATTTTGGGG + Intergenic
1097789425 12:63798480-63798502 CTGAATCAAATGAAATTTTTTGG + Intronic
1098676539 12:73295930-73295952 CAGTTTCACCTGAACTTTTGTGG + Intergenic
1100006144 12:89897862-89897884 CAGAATCACCTGGAGTGTTCTGG - Intergenic
1100080685 12:90846442-90846464 GAGAAACAACAGAAGTTGTGGGG - Intergenic
1100098806 12:91077066-91077088 TCGAATCAATTTAAGTTTTGGGG + Intergenic
1101611947 12:106301006-106301028 CAGAATTACCAGAAGTTTGGGGG + Intronic
1104380729 12:128305492-128305514 CAGAATCATCTAAAGTTCGGCGG - Intronic
1105940961 13:25147625-25147647 CTGACTCAACTGTAGATTTGTGG + Intergenic
1107497418 13:40941070-40941092 CACAACCATCAGAAGTTTTGAGG - Exonic
1108002169 13:45914124-45914146 TAGAAACAGCTGAAGTTTAGTGG - Intergenic
1110399449 13:75072796-75072818 ATGAATAAACTGAAGTTTAGAGG - Intergenic
1110794406 13:79620150-79620172 TAGGATCAACTGATGTTTTGGGG - Intergenic
1111283512 13:86059385-86059407 CAGAATCAGCTGGAGCTCTGTGG + Intergenic
1111297484 13:86300935-86300957 CAGAATCAAATAAAGATTTGTGG + Intergenic
1112108294 13:96266163-96266185 TTGAATCATCTGATGTTTTGTGG + Intronic
1112957838 13:105083512-105083534 GAGAATCATGTGAAGTTTTGGGG - Intergenic
1114058495 14:18997900-18997922 CAGAAGTAACTGTGGTTTTGTGG + Intronic
1114104051 14:19403854-19403876 CAGAAGTAACTGTGGTTTTGTGG - Intronic
1115708262 14:36020776-36020798 CAGAATGATCTGTAGTTTAGTGG + Intergenic
1115751115 14:36490831-36490853 CAGAACCAACTTCAGCTTTGTGG + Intronic
1116171269 14:41406131-41406153 CAGAATCAACTGCAGCATTAGGG - Intergenic
1116418175 14:44703597-44703619 CAGAATCTCCTGACATTTTGAGG + Intergenic
1117520055 14:56542396-56542418 CTGAATTAAATGAGGTTTTGGGG - Intronic
1118012078 14:61619833-61619855 TAAAAGCAAATGAAGTTTTGAGG + Intronic
1118425779 14:65659918-65659940 CAGAATCAATTTAACTGTTGAGG - Intronic
1119082123 14:71704923-71704945 CAGAATCAACTTTTGGTTTGGGG - Intronic
1120658935 14:87230119-87230141 TGGAATGAACTGAAATTTTGGGG - Intergenic
1122562022 14:102622605-102622627 CAGAAGAAACTGAAGATTAGGGG - Intronic
1122615907 14:103017822-103017844 CAGATTCCACTGAAGCATTGCGG - Intronic
1124018981 15:25902841-25902863 CAGAATCAAGTGCTATTTTGTGG - Intergenic
1125542688 15:40479427-40479449 CATAATCAGGTGATGTTTTGTGG - Intergenic
1126254018 15:46603559-46603581 CAGAACCACCTGGAGTTATGTGG - Intergenic
1127076424 15:55331015-55331037 CAGAATCCAAGGCAGTTTTGGGG + Intronic
1127666051 15:61148161-61148183 GAGGAGCCACTGAAGTTTTGAGG + Intronic
1127762746 15:62154973-62154995 CAGAATAAGCAGGAGTTTTGAGG + Intergenic
1128605246 15:69032003-69032025 CAGAATCAACTCAAGGTCTGAGG + Intronic
1128847298 15:70911021-70911043 CTGAATAATGTGAAGTTTTGAGG + Intronic
1130920789 15:88342852-88342874 CAGAATCTCCTCAAGTATTGTGG - Intergenic
1131070555 15:89463088-89463110 CAGAGGCAACTGCAGGTTTGTGG + Intergenic
1133407921 16:5540766-5540788 CAGAATCACCTGGAGCTTTTTGG + Intergenic
1133622036 16:7535618-7535640 AAGAACCAACTCTAGTTTTGAGG - Intronic
1134233416 16:12447075-12447097 CAGAATCACTTGAAGTTGGGAGG + Intronic
1134612454 16:15620073-15620095 GAGAATCACCTGAACTTGTGAGG + Intronic
1135531018 16:23254737-23254759 CAGATTTAACTGAAGGCTTGGGG + Intergenic
1136641037 16:31565435-31565457 CCCAATCAACTGAATTCTTGAGG + Intergenic
1136663938 16:31791885-31791907 CCCAATCAACTGAATTTTTGAGG - Intronic
1140277577 16:73524394-73524416 AAACATCAACTGAAGTCTTGCGG + Intergenic
1140610030 16:76587209-76587231 CAGGCTTAAGTGAAGTTTTGAGG + Intronic
1140716139 16:77727358-77727380 AGGAATCAGCTGGAGTTTTGTGG + Intronic
1142531447 17:582243-582265 CAGAATGCACTGAGGTTCTGAGG - Intronic
1142785287 17:2216936-2216958 AAGAAGCAACTTAGGTTTTGAGG - Intronic
1142934616 17:3317979-3318001 CAAAATAAACTGAAGTGGTGTGG - Intergenic
1146038672 17:29430927-29430949 CATGATCATCTGAAGTTTGGTGG + Intronic
1146074579 17:29716226-29716248 CAGGATCAAGTTAAGGTTTGGGG - Intronic
1146384805 17:32360463-32360485 CAGTATTAATTGAATTTTTGGGG + Intronic
1153814084 18:8778146-8778168 CAGAATTAAGTGTAGTTTGGGGG + Intronic
1154373151 18:13784655-13784677 AAGGATCAACTGTAGTTTTACGG - Intergenic
1154454983 18:14512856-14512878 CAGAAGCAACTGTGATTTTGTGG - Intronic
1155797116 18:30054296-30054318 CATAATCAGCTGCAGGTTTGCGG + Intergenic
1155994907 18:32320847-32320869 CAGAATTACCAGAAGTTTTCTGG + Intronic
1156775005 18:40776758-40776780 CAGAAACACCTAAAGTTTTCAGG - Intergenic
1158239362 18:55359778-55359800 AGGAATCAGCAGAAGTTTTGTGG - Intronic
1158251329 18:55490997-55491019 CATAATCAACTGAAGTTTAATGG - Intronic
1159539129 18:69753116-69753138 AAGAATCTTCTGAAGTTTAGGGG + Intronic
1164253726 19:23508737-23508759 CAAAAGGAACTGAAGTTTTCAGG + Intergenic
1164828252 19:31300129-31300151 CAGAATCAATGGAAGGCTTGTGG - Intronic
1165393110 19:35549601-35549623 CAGAAACAACTGAAGCCATGGGG + Intergenic
1166277849 19:41767501-41767523 CAGATTTATCTGAATTTTTGTGG - Intronic
1166418923 19:42619242-42619264 CAGATTTATCTGAATTTTTGTGG + Intronic
926110429 2:10179591-10179613 AAGAAGCATCTGAAGTTATGAGG - Intronic
926439065 2:12868585-12868607 CAAACTCAACTGCAGTTCTGAGG + Intergenic
926781874 2:16480456-16480478 AAAAATCAACTGGATTTTTGAGG + Intergenic
927159759 2:20245776-20245798 CAGAAGCTGCTGAAGTTTTGTGG - Intergenic
927163866 2:20297409-20297431 CAGAATGAACTAAAGTTTCCAGG - Intronic
928022230 2:27714276-27714298 CAGCATCCAATAAAGTTTTGTGG - Intronic
928245328 2:29621755-29621777 CAGAAGCAATTGAATTCTTGAGG - Intronic
928740559 2:34347274-34347296 TAGAATAATCTGATGTTTTGTGG - Intergenic
932096760 2:68857250-68857272 GAGAATCTTCTGAAGTTCTGGGG + Intergenic
932156338 2:69421455-69421477 CAGCATCAGTTGAAATTTTGGGG - Intronic
932372214 2:71200002-71200024 CAGATTGAAATGTAGTTTTGGGG - Intronic
932688032 2:73890332-73890354 CTGAATAAACTGAAGCTCTGAGG - Intergenic
934477300 2:94602196-94602218 CAGGCCCACCTGAAGTTTTGGGG - Intronic
937608374 2:123828850-123828872 CAGATTCAACAGAAGTTTACTGG + Intergenic
938476969 2:131625172-131625194 CAGAAGTAACTGTGGTTTTGTGG + Intergenic
940138616 2:150467602-150467624 GAGAATCAACTGGATTTATGGGG + Intergenic
940870852 2:158859208-158859230 CAGTGTCCACAGAAGTTTTGGGG - Intronic
940894211 2:159064759-159064781 CAGAGTAAGCAGAAGTTTTGTGG - Intronic
941107668 2:161376926-161376948 CAAAATTAACTGCAGTTTTTTGG - Intronic
942852473 2:180505470-180505492 CAGAATAAACTGACATTATGTGG + Intergenic
944617739 2:201479888-201479910 CAGAATCAAAGGCAGTTTTAGGG + Intronic
945182693 2:207107844-207107866 GCGAACCCACTGAAGTTTTGAGG - Intronic
945798984 2:214401173-214401195 AAGAAACTACTTAAGTTTTGAGG - Intronic
945804331 2:214471721-214471743 CAAAATCAAATGGAGGTTTGGGG + Intronic
945868193 2:215200114-215200136 CAGAAAAAACAGAAGTTTTGAGG + Intergenic
1170178070 20:13495419-13495441 CAGTATCAAGGGAAGTTTTGAGG + Intronic
1170518966 20:17163382-17163404 CAGAATGAACTGTAGGTGTGTGG + Intergenic
1171844469 20:30256961-30256983 CAGAATCAGCTGAACTTGGGAGG - Intergenic
1176819181 21:13640442-13640464 CAGAAGCAACTGTGATTTTGTGG + Intronic
1177620405 21:23584598-23584620 TAAAATCCACTGAAATTTTGAGG + Intergenic
1180476982 22:15720519-15720541 CAGAAGTAACTGTGGTTTTGTGG + Intronic
1181413630 22:22744131-22744153 CTGAATCAACAGCAGTATTGGGG + Intronic
1183737167 22:39650532-39650554 GAGGAGCAACAGAAGTTTTGAGG - Intronic
951599359 3:24356262-24356284 CAGGACCACCTGGAGTTTTGGGG - Intronic
952182045 3:30927248-30927270 CATAATCAACACAGGTTTTGAGG - Intergenic
953141874 3:40236774-40236796 CAGAGTCAACTGTGCTTTTGAGG + Intronic
953556637 3:43951366-43951388 CAGGCACAACTGAAGTTTGGAGG + Intergenic
954538861 3:51380849-51380871 CAGAATCATCTGCATTTCTGTGG - Intronic
955649705 3:61180662-61180684 CTGAATCAACTTATTTTTTGAGG - Intronic
955820665 3:62892404-62892426 CAGAGTAAAGTGAAATTTTGGGG - Intergenic
955842013 3:63122741-63122763 CAAAAGGAACTGAAGTTGTGTGG + Intergenic
955901178 3:63757050-63757072 CAGAGTCACTTGAAGATTTGGGG + Intergenic
956415607 3:69025513-69025535 TAGAAGTAAATGAAGTTTTGAGG - Intronic
956437993 3:69253127-69253149 CAGAATCAAAGATAGTTTTGGGG + Intronic
958421365 3:93935351-93935373 CAAAATCAAATGATGTTTTGGGG - Intronic
958913215 3:100018399-100018421 CAAAATATGCTGAAGTTTTGTGG - Intronic
958955584 3:100462858-100462880 CAGAATTAATTCAAGTTTTAGGG - Intergenic
959171590 3:102850209-102850231 CAGAATCAACTTTACTTTTTGGG - Intergenic
960347709 3:116555258-116555280 CAGTATCTATTGAAGTATTGAGG + Intronic
961917972 3:130397165-130397187 CAGAATACATTAAAGTTTTGAGG - Intronic
962746864 3:138403322-138403344 CAGCATGAACTGGAGTTTTCTGG - Exonic
963562996 3:146890336-146890358 CAAAATCAAGTAAAGTTTAGAGG + Intergenic
965244408 3:166249015-166249037 CAGAGTAAACTATAGTTTTGTGG + Intergenic
965550330 3:169958529-169958551 CAGAATCCAGGGAAGTTATGAGG - Intergenic
965851529 3:173032188-173032210 CAGAATTAATTGTAATTTTGGGG - Intronic
967718684 3:192791848-192791870 CAGACTCATCTGATCTTTTGTGG - Intergenic
971879375 4:32350011-32350033 CAGAATCAAGAGAGGTTTTCTGG + Intergenic
972383849 4:38544562-38544584 CAGAATCCACTGAAGACTGGAGG + Intergenic
973155208 4:46943269-46943291 CAGAAACAGCTGAAGTTTTGTGG - Intronic
979356317 4:119710407-119710429 CAGAATTAATTAATGTTTTGAGG - Intergenic
980460983 4:133112956-133112978 AAGAATCAACTGATGTTTTCAGG - Intergenic
980715197 4:136618274-136618296 TAGACTGAACTGAGGTTTTGGGG - Intergenic
980766716 4:137315677-137315699 CAGAATCAACTGAGCATGTGTGG + Intergenic
982254185 4:153436128-153436150 GAGAAACTACTGAAGTTTTGGGG - Intergenic
982451667 4:155559949-155559971 ATAAAGCAACTGAAGTTTTGGGG + Intergenic
983087355 4:163463455-163463477 AAGATGCAACTGAATTTTTGTGG + Intergenic
983443392 4:167816795-167816817 CCAAAACAACTGAAGTTATGGGG - Intergenic
983956871 4:173708404-173708426 CAGAATTTCCTGCAGTTTTGAGG + Intergenic
983967345 4:173829109-173829131 CATAATTAACTGAATTTTTTTGG - Intergenic
984210697 4:176844204-176844226 CACAATCAACAGAAGCTTTGAGG + Intergenic
984999091 4:185467218-185467240 CAGAATCATCTGAACTTTGCTGG - Intronic
985234099 4:187853806-187853828 CAGCATAAACTTAAGTTTTGTGG + Intergenic
985292563 4:188401838-188401860 TAGAAATTACTGAAGTTTTGTGG + Intergenic
986425299 5:7625332-7625354 CAGAATGAACTGAAGCTTCTTGG + Intronic
987585722 5:19853587-19853609 CAGAAGCAACTGAAGTTATTAGG + Intronic
988439140 5:31212236-31212258 CAGAAACATCTGACATTTTGGGG - Intronic
989544157 5:42653376-42653398 CAGAAAGATCTGAGGTTTTGGGG - Intronic
989554690 5:42780183-42780205 TAGATTCAACTTGAGTTTTGAGG - Intronic
991267100 5:64732897-64732919 TAGAACCAACTGATTTTTTGGGG + Intronic
992260971 5:74969410-74969432 AAGAATCAACTATAGATTTGGGG + Intergenic
992271715 5:75071215-75071237 AAGACTAAAATGAAGTTTTGAGG + Intronic
992846962 5:80760170-80760192 AAGAATGAACTGATGTTTTGGGG - Intronic
993336872 5:86670634-86670656 CAGAATCACCACATGTTTTGGGG + Intergenic
993870025 5:93241707-93241729 CTGAATAAACAGATGTTTTGTGG + Intergenic
996295821 5:121915223-121915245 TATAATTAACTGAAGTTTTGGGG - Intergenic
998628419 5:143871725-143871747 CAAAATCAACTGAAATTTTAAGG + Intergenic
998806617 5:145923088-145923110 CAGAATCACCTGAAGTACTTGGG + Intergenic
998895146 5:146790857-146790879 CAGAATAAAATGAACTCTTGAGG + Intronic
999005680 5:147974884-147974906 TAGAATTTACTGAAGCTTTGTGG - Intergenic
999075899 5:148795062-148795084 CTGAAATAACTGAAGTTTTGTGG + Intergenic
999375520 5:151083968-151083990 CAGATGAAACTGAAGCTTTGAGG + Intronic
1003239139 6:4327390-4327412 AAGAACCAACTGAAGTTATTGGG + Intergenic
1003926940 6:10884969-10884991 CTGAATCAACAGGAGTTTCGGGG - Intronic
1004040021 6:11966174-11966196 CAGAGACAGCTCAAGTTTTGTGG + Intergenic
1006215284 6:32436802-32436824 CACAAACAAATGAAGTATTGAGG + Intergenic
1008224964 6:48903865-48903887 CAAAATAAGCTGAAGCTTTGTGG - Intergenic
1008249236 6:49217271-49217293 TAGAATCTACTTCAGTTTTGGGG - Intergenic
1008907569 6:56696461-56696483 AAGTATCAAAAGAAGTTTTGCGG - Intronic
1011436347 6:87341958-87341980 CAGAATAAGCTGATGTTTGGTGG + Exonic
1013207058 6:107954823-107954845 CAGAAACAACTCAAGTTATTAGG + Intronic
1015308869 6:131742575-131742597 CAGGATAATCAGAAGTTTTGGGG - Intronic
1016285754 6:142470933-142470955 TAGAATCAAATGATGTTTTCTGG - Intergenic
1016313170 6:142756753-142756775 CAGTATCTACTGAATTTTTGAGG - Intronic
1016493890 6:144637304-144637326 CAGAATCTAATGTAGTTATGTGG + Intronic
1018886076 6:167938818-167938840 CACAATAAACTTCAGTTTTGTGG - Intronic
1021295502 7:18901022-18901044 CACAATCAAGTGAATTTTTGTGG + Intronic
1021403196 7:20233792-20233814 CAGAAACAACTGATGCTTTTTGG + Intergenic
1021821644 7:24504233-24504255 CTGAATCAACTCAAGCTCTGTGG - Intergenic
1023661360 7:42474367-42474389 CAGTATCAGCTGAAGTTATAGGG + Intergenic
1026348653 7:69496667-69496689 GAGAATCAAGTAAAGTCTTGTGG + Intergenic
1030582898 7:111382549-111382571 CAGAATCAAGGGATGGTTTGGGG + Intronic
1030988102 7:116265804-116265826 CAGCATCCACTGTAGTTGTGTGG + Intergenic
1031334735 7:120514571-120514593 CACAATCATGTGAAGTTTTTTGG + Intronic
1033825519 7:145185586-145185608 CAGAAGGAACTGAAATTTTGAGG + Intergenic
1033897099 7:146086349-146086371 CAGAAACAACTGATATTTTCAGG + Intergenic
1034101137 7:148451591-148451613 TAAAATCAACTGGAGTTTTCAGG - Intergenic
1039310399 8:36312308-36312330 CAGAATCAATTCAGGATTTGTGG + Intergenic
1039652421 8:39356608-39356630 CAGAATCAACAAAAGTATTCTGG - Intergenic
1040507834 8:48067440-48067462 CAGAATAAACTGAAGGTTACAGG - Intergenic
1041285407 8:56255922-56255944 CAGAAGCAACTTAACTTTTTGGG - Intergenic
1043010687 8:74878524-74878546 AAGAATGAACTGAAGGTTTCTGG + Intergenic
1044468013 8:92529377-92529399 CTGAGTCATCTGAAATTTTGTGG + Intergenic
1044786047 8:95794162-95794184 CAGAATGAAATGAAGTTTCCTGG - Intergenic
1045718660 8:105079625-105079647 CTGGTTCAACTGAGGTTTTGAGG - Intronic
1046486676 8:114896287-114896309 CAGAAGCAACTGCAGGTTTCTGG + Intergenic
1047316950 8:123743484-123743506 CAAAATCAACTGTAATTTGGGGG - Intergenic
1047660319 8:127026665-127026687 CATATTTGACTGAAGTTTTGGGG - Intergenic
1052001365 9:23285648-23285670 TAGAATCAGCTGAAGTTTGGTGG - Intergenic
1052738517 9:32370390-32370412 CAAAATCAACTGAATCTCTGAGG + Intergenic
1052852670 9:33387366-33387388 CAGGCCCACCTGAAGTTTTGGGG + Intronic
1053680769 9:40483917-40483939 CAGGCCCACCTGAAGTTTTGGGG + Intergenic
1053930755 9:43112229-43112251 CAGGCCCACCTGAAGTTTTGGGG + Intergenic
1054282944 9:63141018-63141040 CAGGCCCACCTGAAGTTTTGGGG - Intergenic
1054293851 9:63319432-63319454 CAGGCCCACCTGAAGTTTTGGGG + Intergenic
1054391876 9:64623921-64623943 CAGGCCCACCTGAAGTTTTGGGG + Intergenic
1054503853 9:65892407-65892429 CAGGCCCACCTGAAGTTTTGGGG - Intronic
1056501521 9:87214490-87214512 CAGAAAGAAATGAAGTTTTAGGG + Intergenic
1059475074 9:114540038-114540060 ATGAAGCAACTGATGTTTTGAGG + Intergenic
1060407646 9:123380823-123380845 CAGAATCAACTGAAGTTTTGGGG + Exonic
1061532951 9:131229092-131229114 CAGCATGAGCTGAAGGTTTGGGG + Intronic
1203528176 Un_GL000213v1:109118-109140 CAGAAGCAACTGTGATTTTGTGG - Intergenic
1187500200 X:19833079-19833101 CAGCATCAGCTCCAGTTTTGAGG - Intronic
1188468859 X:30514589-30514611 CAGAATCAACTGAAGTATCCAGG + Intergenic
1188949426 X:36350577-36350599 CAGAATGTACTGAAGTTTTCAGG + Intronic
1190435148 X:50416986-50417008 CAGAATCAACTTATGATTTTAGG + Intronic
1190435811 X:50423998-50424020 CAGAACCAACTATAATTTTGGGG - Intronic
1190961304 X:55251618-55251640 GAGAATCACCTGAACTTGTGAGG - Intronic
1191992029 X:67048669-67048691 AGGAATAAACTGAAGTTTTCTGG - Intergenic
1192080256 X:68040878-68040900 CAGAATCACCTGAAGATGAGTGG + Intergenic
1192347278 X:70321311-70321333 AAGACTCAACTTAAGTGTTGGGG + Intronic
1193097390 X:77565553-77565575 AAGAATCAACTGAAAATTTTAGG + Intronic
1193368161 X:80659538-80659560 CAGTTTCAACTTGAGTTTTGGGG - Intergenic
1194113194 X:89863515-89863537 CAGAATCAACTTCAGATTTAGGG + Intergenic
1194151819 X:90335119-90335141 CAGAAGCAACAGATGTATTGTGG + Intergenic
1197330067 X:125142718-125142740 TAGAATGACCTGAAGCTTTGTGG - Intergenic
1200465880 Y:3518571-3518593 CAGAATCAACTTTAGATTTAGGG + Intergenic
1200498175 Y:3911884-3911906 CAGAAGCAACAGATGTATTGTGG + Intergenic