ID: 1060409765

View in Genome Browser
Species Human (GRCh38)
Location 9:123392503-123392525
Sequence GCTCGTCAGCACCTGCCCAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 141
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 129}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060409765_1060409777 21 Left 1060409765 9:123392503-123392525 CCAGTGGGCAGGTGCTGACGAGC 0: 1
1: 0
2: 1
3: 10
4: 129
Right 1060409777 9:123392547-123392569 GCTAGGTCCTGCCTGTCCGGTGG No data
1060409765_1060409768 -7 Left 1060409765 9:123392503-123392525 CCAGTGGGCAGGTGCTGACGAGC 0: 1
1: 0
2: 1
3: 10
4: 129
Right 1060409768 9:123392519-123392541 GACGAGCAGGGACAGCCCCCAGG No data
1060409765_1060409778 22 Left 1060409765 9:123392503-123392525 CCAGTGGGCAGGTGCTGACGAGC 0: 1
1: 0
2: 1
3: 10
4: 129
Right 1060409778 9:123392548-123392570 CTAGGTCCTGCCTGTCCGGTGGG No data
1060409765_1060409771 4 Left 1060409765 9:123392503-123392525 CCAGTGGGCAGGTGCTGACGAGC 0: 1
1: 0
2: 1
3: 10
4: 129
Right 1060409771 9:123392530-123392552 ACAGCCCCCAGGGTGAGGCTAGG No data
1060409765_1060409776 18 Left 1060409765 9:123392503-123392525 CCAGTGGGCAGGTGCTGACGAGC 0: 1
1: 0
2: 1
3: 10
4: 129
Right 1060409776 9:123392544-123392566 GAGGCTAGGTCCTGCCTGTCCGG No data
1060409765_1060409770 -1 Left 1060409765 9:123392503-123392525 CCAGTGGGCAGGTGCTGACGAGC 0: 1
1: 0
2: 1
3: 10
4: 129
Right 1060409770 9:123392525-123392547 CAGGGACAGCCCCCAGGGTGAGG No data
1060409765_1060409769 -6 Left 1060409765 9:123392503-123392525 CCAGTGGGCAGGTGCTGACGAGC 0: 1
1: 0
2: 1
3: 10
4: 129
Right 1060409769 9:123392520-123392542 ACGAGCAGGGACAGCCCCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060409765 Original CRISPR GCTCGTCAGCACCTGCCCAC TGG (reversed) Intronic
900108825 1:997251-997273 GCTCCACACCACCTGCCCCCTGG - Intergenic
900367702 1:2317998-2318020 GCTCGCCTGCCCCTGCTCACTGG - Intergenic
900705402 1:4077179-4077201 GTTGGGCAGCATCTGCCCACAGG + Intergenic
901027319 1:6285457-6285479 GCTGGCCGTCACCTGCCCACGGG + Intronic
901083012 1:6593900-6593922 GCTCGGCACGACCTGCACACGGG - Intronic
902241815 1:15094804-15094826 GCTCAGCAGCACCTGCCCCCGGG - Exonic
903891221 1:26571838-26571860 GCGCTTCAGCACCTGGCAACAGG - Exonic
905221107 1:36448551-36448573 GCTCCTCAGTACCTTACCACTGG - Intronic
905663742 1:39749096-39749118 CCTCGTCACCACATGCCAACTGG - Intronic
905949729 1:41939392-41939414 ACTCGTCAGCACCTGCCTGGTGG - Intronic
907261541 1:53222063-53222085 GCTCGCCAGAACCTGACCACTGG - Intergenic
907265180 1:53254922-53254944 GCTCTTCAGGACCTGGCCCCAGG - Intronic
908263781 1:62359216-62359238 GCTTGTCACCACCTGCACAAGGG - Intergenic
915302482 1:154959445-154959467 GCCCGGCATCATCTGCCCACTGG + Exonic
918060705 1:181058980-181059002 GCTTGTTAGCACCTGCTCTCTGG + Exonic
922241560 1:223758628-223758650 ACTCGGAAGCACATGCCCACAGG - Intronic
924382105 1:243474619-243474641 GCACGCCAGCACCTGCTCTCGGG - Intronic
1063964637 10:11337607-11337629 GCTCTTCAGCGCCTGCGCCCAGG - Intergenic
1069604547 10:69731294-69731316 ACTTGGCAGCAGCTGCCCACCGG - Intergenic
1076835217 10:133017480-133017502 GCACGTCAGCACCTGGCGCCCGG - Intergenic
1077178282 11:1200416-1200438 GCTGAGCAGCCCCTGCCCACAGG + Intronic
1078222669 11:9364559-9364581 GCGCGTCAGCCCCTCCCCGCCGG - Intergenic
1079495768 11:21042385-21042407 GCTCATGAGCAGCAGCCCACAGG + Intronic
1085460080 11:76688318-76688340 GCTGCTCACCACCTGCTCACAGG - Intergenic
1088135476 11:106551979-106552001 GCTGGACAGGACCTGCCCCCAGG + Intergenic
1089093261 11:115896556-115896578 GCTTGTCAGAACCTGGCCAATGG - Intergenic
1093738182 12:22648721-22648743 GCTCGTCAGCATTTACCCAAAGG - Intronic
1095227099 12:39690134-39690156 GCTGGGTTGCACCTGCCCACAGG + Intronic
1095446558 12:42288185-42288207 GGTCATCATCACCTGGCCACCGG + Intronic
1100618402 12:96249358-96249380 GCGCGTCACCACCAGCTCACAGG - Intronic
1102043490 12:109815561-109815583 GCTGGTCAACTCCTCCCCACTGG + Intronic
1104516490 12:129431831-129431853 GCTCTTCTGCACCCTCCCACTGG + Intronic
1107332265 13:39313884-39313906 GCCTGTCAGTACCTGCCCACCGG + Intergenic
1113615983 13:111681044-111681066 GCTGGCCAGCCCCTGCCCAGTGG + Intergenic
1113621451 13:111765937-111765959 GCTGGCCAGCCCCTGCCCAGTGG + Intergenic
1113627211 13:111856149-111856171 GCTCTGCAGCACCTGCTCTCTGG - Intergenic
1117092835 14:52267889-52267911 GCTCTTCAGCACCGGCCTCCTGG + Exonic
1120949754 14:90030165-90030187 GCTCGGCAGCACCTGCCCCCAGG - Intronic
1121027828 14:90629575-90629597 GCTCCCCAGCACCTGGCCCCGGG - Intronic
1123016387 14:105377526-105377548 GCTCCTCAGCAGCTGCCCAGAGG - Intronic
1125956542 15:43794425-43794447 GCTTGACAGCAGCTGACCACGGG - Exonic
1127153161 15:56099471-56099493 GCTTCTCAGCACCTGCACTCTGG + Intronic
1129650000 15:77478463-77478485 GCTGGTCAGCACCTGCCGCAGGG - Exonic
1132574188 16:657142-657164 GCTCTTCAGCTCCTGCTCCCAGG + Exonic
1134061586 16:11202697-11202719 GCTAGGCTGCACCTGCCCCCTGG + Intergenic
1134263316 16:12671562-12671584 GCTGATCCACACCTGCCCACAGG - Intronic
1135202198 16:20447178-20447200 GCTCCTTTGCACCTGGCCACTGG - Intergenic
1135216906 16:20580688-20580710 GCTCCTTTGCACCTGGCCACTGG + Intergenic
1140472939 16:75225175-75225197 CATCCTCAGCACCTGCCCCCAGG + Intergenic
1141183428 16:81770250-81770272 GCTCATCACCACCTTCCCAAGGG + Intronic
1144021652 17:11243676-11243698 TCAGGACAGCACCTGCCCACGGG - Intronic
1144493299 17:15732454-15732476 CCTCCTCGGCACCTGCCCAGAGG - Intronic
1144502876 17:15804863-15804885 GCTCTTCAGCACCTGGACACAGG + Intergenic
1144906659 17:18642706-18642728 CCTCGTCGGCATCTGCCCAGAGG + Intronic
1144906962 17:18644198-18644220 CCTCCTCGGCACCTGCCCAGAGG + Intronic
1145165057 17:20607528-20607550 GCTCTTCAGCACCTGGACACAGG + Intergenic
1145759477 17:27418166-27418188 CCTCCTCAGCACGTGCCCAGAGG - Intergenic
1151381384 17:73728077-73728099 CCTGCTCAGCACCGGCCCACTGG - Intergenic
1151658996 17:75508850-75508872 GCTGATCAGAACCTGCTCACGGG + Intronic
1151662397 17:75525736-75525758 GCTCCGCCGCGCCTGCCCACGGG - Exonic
1152214798 17:79025725-79025747 CCTCTCCAGCACCTGCCAACCGG + Intronic
1152537845 17:80960754-80960776 CATGGACAGCACCTGCCCACAGG - Intronic
1152537867 17:80960841-80960863 CCCGGACAGCACCTGCCCACGGG - Intronic
1152564536 17:81094296-81094318 TCTGGTGAGCACATGCCCACGGG - Intronic
1160782983 19:886043-886065 GGACGTCAGCACCTGCCCGCTGG + Exonic
1161299303 19:3535166-3535188 TCTGTTCATCACCTGCCCACCGG + Intronic
1162131698 19:8530037-8530059 GCCCATATGCACCTGCCCACAGG - Intronic
1162797029 19:13092364-13092386 GCTCCCCGGCACCTCCCCACAGG - Intronic
1165014530 19:32870975-32870997 CCTAGACAGAACCTGCCCACCGG + Intergenic
1166046936 19:40235363-40235385 GGCCGTCAGCACCTGCCTCCCGG + Intronic
926700176 2:15798240-15798262 CGCCGTCACCACCTGCCCACGGG + Intergenic
928178698 2:29052744-29052766 ACTCGGCAGCATCTGCACACTGG - Exonic
932432383 2:71683713-71683735 CCTGGTCAGCACCAGGCCACTGG + Intronic
933660714 2:84925407-84925429 GGTCCTCTCCACCTGCCCACAGG + Intergenic
936344517 2:111665157-111665179 GCCCACCACCACCTGCCCACCGG + Intergenic
936611443 2:114005678-114005700 GCACGACAATACCTGCCCACTGG - Intergenic
936648799 2:114402868-114402890 GTTCATCAGCACCTGCCTAATGG - Intergenic
945929387 2:215839972-215839994 GCTGGTCAGCATTTGCCCACAGG - Intergenic
947839366 2:233197889-233197911 CCTCGTAAGCACCTGGCCCCAGG - Intronic
948465728 2:238150766-238150788 GCTCTCCAGCTCCCGCCCACCGG + Intronic
1170746215 20:19101147-19101169 GCTGGTCAGAACCATCCCACTGG + Intergenic
1175270230 20:57728685-57728707 CCTCCCCAGCACCTGCACACAGG + Intergenic
1176010243 20:62889516-62889538 GCACCTCAGCACCTCCCTACCGG - Intronic
1176816197 21:13606228-13606250 GCTCGTCAACTCCTGACCTCAGG - Intergenic
1178582554 21:33848743-33848765 CCTCCTCTGCACCTGCCCCCAGG + Intronic
1179595947 21:42443393-42443415 AATCGTCAACACCTGTCCACAGG + Exonic
1179960615 21:44765326-44765348 CCACGTCAGCCTCTGCCCACAGG + Intergenic
1182299428 22:29329478-29329500 GCAGGTCAGCAGCAGCCCACGGG + Intronic
1184859687 22:47166117-47166139 ACTCGTCAACACCTGCTCCCGGG - Intronic
1185220093 22:49624886-49624908 CCTCCTCAGCACCTCCCCGCAGG + Exonic
950163109 3:10774645-10774667 GGTCAGCAGCACCTGCCCACTGG + Intergenic
953182172 3:40605978-40606000 GTTCCTCAGCACTTGCCCAGAGG + Intergenic
954295936 3:49674478-49674500 GCTCAGCAGCACCTGCGCAGGGG - Exonic
955026314 3:55171168-55171190 GCTCCTCAGCACCTCCCACCTGG + Intergenic
955217602 3:56997313-56997335 GCTCTGCAGGACCTCCCCACAGG - Intronic
966417696 3:179706342-179706364 GCTCGGCACCAACTGACCACAGG - Intronic
966933641 3:184691622-184691644 GCTGGGCAGCAGCTGCCAACAGG - Intergenic
969847998 4:9934805-9934827 TCCCCTCAGCCCCTGCCCACAGG + Intronic
980316218 4:131204345-131204367 GCTCTTCAACACCTGACCTCAGG - Intergenic
985596034 5:788578-788600 CCTCATCAGCACCTGACCAGTGG - Intergenic
990556129 5:56937659-56937681 CCTCGTCATCACCTGACAACAGG + Exonic
992272482 5:75079690-75079712 GGTCTTCAGCTCCTGACCACAGG + Intronic
992386605 5:76290691-76290713 GCTAGTCAGCAAATACCCACAGG - Intronic
998113757 5:139521287-139521309 CCTCTTAATCACCTGCCCACTGG + Intergenic
998117556 5:139549561-139549583 GGGCCTCAGCACCTGCCCGCAGG + Intronic
998783557 5:145684765-145684787 GCTGGTCATTACCTGCCCCCAGG - Intronic
999668332 5:153936013-153936035 CCTCATCAACACCTGCCCAATGG + Intergenic
999802003 5:155046914-155046936 GCAGGTCAGCACTTACCCACCGG - Intergenic
1000006117 5:157186456-157186478 GCTCGTGAACTCCTGCCCTCAGG - Intronic
1000296477 5:159916934-159916956 ACACATCAGCACCTGCCCACTGG + Exonic
1002180152 5:177427054-177427076 CCTCCTCCGCACCTGCCCCCGGG + Intronic
1006187180 6:32188169-32188191 GCTCCTCCTCACCAGCCCACTGG - Intronic
1018062709 6:160103150-160103172 GCTGGCCAGCTCCTGCCCCCAGG - Intronic
1018988734 6:168657516-168657538 TGTATTCAGCACCTGCCCACTGG + Intronic
1022348322 7:29539615-29539637 GCACCTCAGGACCTGCCCAGGGG + Intergenic
1022949262 7:35320114-35320136 GCCCTGGAGCACCTGCCCACTGG + Intergenic
1023917513 7:44601182-44601204 GTTCTCCAACACCTGCCCACTGG - Intergenic
1024157214 7:46638089-46638111 GCTCGGCAGCCCCTGGACACAGG + Intergenic
1024551627 7:50566933-50566955 GACCGTCATCCCCTGCCCACTGG - Intergenic
1025032215 7:55567138-55567160 TCTACTCAGCTCCTGCCCACAGG + Intronic
1032020135 7:128403107-128403129 CCTCTTCTGAACCTGCCCACAGG + Intronic
1032095751 7:128937894-128937916 GCTCAGCAGCAGCTGCCCAGGGG + Intronic
1035209620 7:157318166-157318188 GCTTGTCAGGGCCTGCCCAGTGG + Intergenic
1038480136 8:27896225-27896247 GGATGTCAGCACCTCCCCACAGG - Intronic
1038695600 8:29803836-29803858 CCTTGTCAGCACCAGCCAACAGG - Intergenic
1039156284 8:34562175-34562197 TCTTATTAGCACCTGCCCACAGG - Intergenic
1039786899 8:40841941-40841963 GCCTGGCAGCACGTGCCCACAGG + Intronic
1040992264 8:53365301-53365323 GGTCATCAGCACCAGCCCAGGGG + Intergenic
1045504592 8:102769438-102769460 GCTCATCAACAACTCCCCACAGG - Intergenic
1048421742 8:134284250-134284272 GCAGTTCAGCACCAGCCCACAGG - Intergenic
1049661301 8:143820852-143820874 GGCCGCCAGCACCTGCCCAGGGG + Intronic
1052273592 9:26653351-26653373 GCTCCTCAGCACCCTCCCCCGGG - Intergenic
1055728510 9:79257423-79257445 CCTCTTCAGCACCTGCCTCCTGG - Intergenic
1060409765 9:123392503-123392525 GCTCGTCAGCACCTGCCCACTGG - Intronic
1060590290 9:124812019-124812041 GCTCATCCTCACCTGCCCCCTGG + Exonic
1060996324 9:127876573-127876595 GCCCCTCAGCAGCTGCCCATGGG + Intronic
1061199842 9:129131451-129131473 GCCCCTGGGCACCTGCCCACTGG + Intronic
1061753296 9:132795611-132795633 GATGGTCAGCAACTACCCACTGG - Intronic
1062088498 9:134661421-134661443 ATCCGTCAGCATCTGCCCACAGG - Intronic
1188477769 X:30605273-30605295 GCTCCTCAGCTTCTGCCTACAGG - Intergenic
1189919970 X:45893909-45893931 TCTCTTAAGCCCCTGCCCACAGG - Intergenic