ID: 1060416607

View in Genome Browser
Species Human (GRCh38)
Location 9:123435134-123435156
Sequence GCAGGTGCTCCCATGTTCTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 209
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 197}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060416607_1060416616 13 Left 1060416607 9:123435134-123435156 CCTGAGAACATGGGAGCACCTGC 0: 1
1: 0
2: 1
3: 10
4: 197
Right 1060416616 9:123435170-123435192 GAGGCAATGGCTGAAGTGAAGGG No data
1060416607_1060416612 -6 Left 1060416607 9:123435134-123435156 CCTGAGAACATGGGAGCACCTGC 0: 1
1: 0
2: 1
3: 10
4: 197
Right 1060416612 9:123435151-123435173 ACCTGCTGGAGGTGGTGAGGAGG No data
1060416607_1060416614 0 Left 1060416607 9:123435134-123435156 CCTGAGAACATGGGAGCACCTGC 0: 1
1: 0
2: 1
3: 10
4: 197
Right 1060416614 9:123435157-123435179 TGGAGGTGGTGAGGAGGCAATGG No data
1060416607_1060416617 25 Left 1060416607 9:123435134-123435156 CCTGAGAACATGGGAGCACCTGC 0: 1
1: 0
2: 1
3: 10
4: 197
Right 1060416617 9:123435182-123435204 GAAGTGAAGGGAATTGCATGTGG No data
1060416607_1060416615 12 Left 1060416607 9:123435134-123435156 CCTGAGAACATGGGAGCACCTGC 0: 1
1: 0
2: 1
3: 10
4: 197
Right 1060416615 9:123435169-123435191 GGAGGCAATGGCTGAAGTGAAGG No data
1060416607_1060416611 -9 Left 1060416607 9:123435134-123435156 CCTGAGAACATGGGAGCACCTGC 0: 1
1: 0
2: 1
3: 10
4: 197
Right 1060416611 9:123435148-123435170 AGCACCTGCTGGAGGTGGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060416607 Original CRISPR GCAGGTGCTCCCATGTTCTC AGG (reversed) Intronic
902686137 1:18078868-18078890 ACATGTGCTCCCATGTGCACAGG - Intergenic
903357468 1:22756713-22756735 GCAGGTGCCGCCTTGTTCTGGGG - Intronic
903906684 1:26692981-26693003 GGATGTGCTCCCATTTTATCCGG - Intergenic
904476035 1:30765179-30765201 GCAGGGGCTGCCATCTGCTCAGG + Intergenic
907299514 1:53477780-53477802 GCCAGCGCTCCCATGTGCTCAGG - Intergenic
907761858 1:57368565-57368587 GCAGGTCGTCCCATCATCTCTGG - Intronic
909599737 1:77448840-77448862 CCAGGTGCCACCATGTTCCCTGG + Intronic
912263805 1:108134130-108134152 GCATCTGCTCCTCTGTTCTCAGG - Exonic
918450425 1:184652234-184652256 GCAGGTGTTGCCTTGTTGTCCGG - Intergenic
920135317 1:203764598-203764620 GCTGGTGATCTCCTGTTCTCAGG - Intergenic
920183536 1:204147091-204147113 CCAGGTGCCCCTCTGTTCTCAGG - Intronic
921938749 1:220818280-220818302 GCACCTGCTCCCATGCTCTGTGG + Exonic
922904096 1:229160595-229160617 GCAGCTTCTGCCTTGTTCTCTGG + Intergenic
1067018645 10:42776107-42776129 GTAGGGGTTCCCATGGTCTCTGG - Intergenic
1067247352 10:44557969-44557991 GGAGCTGGGCCCATGTTCTCTGG + Intergenic
1067555263 10:47265072-47265094 GCAGGGGCTCCCAGGTTCAAAGG - Intergenic
1067716269 10:48693182-48693204 TCCGCAGCTCCCATGTTCTCTGG - Intronic
1070181518 10:74018536-74018558 GAAGGTATTCCCATTTTCTCTGG - Intronic
1072611189 10:97018618-97018640 GCAGGTGCCCCCATTTTCACAGG + Exonic
1073670178 10:105579383-105579405 CCGGGTGCTGCCATGTTCCCTGG - Intergenic
1076576913 10:131475388-131475410 GCAGATGCTGCCATGCTTTCTGG - Intergenic
1076764502 10:132625602-132625624 GCAGAGGCTCCCATGTCCCCGGG - Intronic
1076879303 10:133232001-133232023 GAAGGTCCTCCCATGGCCTCGGG + Intergenic
1077114077 11:875205-875227 CCAGGTGCTCCTATCTTCACAGG + Intronic
1077123626 11:922559-922581 GCAGGTGCTCAGATGATCACGGG + Intergenic
1077604920 11:3603153-3603175 GCAGGTGATCCCTTGAGCTCAGG + Intergenic
1081535705 11:43994860-43994882 GCAGGTGATCCCTTGAGCTCAGG - Intergenic
1083989594 11:66238852-66238874 GCTGGGGCTCCCTTGTTCTGTGG + Intronic
1084445417 11:69200724-69200746 GCAGGTGCTGCTATTGTCTCAGG + Intergenic
1085119173 11:73956317-73956339 GCAGCTCCTCCCAGCTTCTCTGG - Intronic
1085875699 11:80404398-80404420 GGAGGGGCTGCCATGGTCTCTGG - Intergenic
1088529837 11:110797138-110797160 GCAGGTGGTCCCAGCTACTCGGG + Intergenic
1089145632 11:116327935-116327957 CCAGGTACTCCCATGGGCTCTGG + Intergenic
1089618561 11:119709315-119709337 GCTGGTGATCCCAGATTCTCAGG - Intronic
1090405619 11:126474424-126474446 CCTGGTGCTCCCAGGTTCCCTGG - Intronic
1091949561 12:4581547-4581569 GAAAGTGCTCCCATGCTCCCCGG - Intronic
1091989579 12:4944152-4944174 GCGGGTGTTCCCAGGTTCACGGG + Intergenic
1092978491 12:13769435-13769457 GCATATGCTCCCAAGTTCCCAGG + Intronic
1095826193 12:46531990-46532012 CCAGGTGCCACCATGTTCCCTGG + Intergenic
1095850387 12:46797430-46797452 GCAGGAGCTCCAATGTTCAAGGG - Intronic
1098469856 12:70830756-70830778 GCAGCTGCTCCTTTTTTCTCTGG - Intronic
1100438150 12:94590768-94590790 GGAGTTGCTCCTGTGTTCTCAGG + Intronic
1102360750 12:112285574-112285596 GCAGGTGGATCCCTGTTCTCAGG - Intronic
1103940222 12:124497326-124497348 GGACGTGTTCCCATGTTCACGGG - Intronic
1104015676 12:124960160-124960182 GCAGGTGCTCCCAGGGCTTCTGG - Intronic
1104106019 12:125659958-125659980 GTCAGTGCTCCCATGTTCCCAGG - Exonic
1104651172 12:130535150-130535172 GCAGCTGCTGCTCTGTTCTCTGG + Intronic
1105513960 13:21074848-21074870 GCAGGAGCCTCCATGTTCTTTGG - Intergenic
1106575486 13:30970643-30970665 GCAGATGCTCCCATCTGCCCAGG + Intronic
1106906479 13:34414724-34414746 GCAGGTGCTCCCAGCTGCCCAGG + Intergenic
1108282743 13:48875983-48876005 ACAGGTGCTCACATGCACTCTGG - Intergenic
1113327449 13:109295539-109295561 GCAGGGGTGCTCATGTTCTCAGG - Intergenic
1113356023 13:109580953-109580975 CCAGTGGCTCCCCTGTTCTCAGG + Intergenic
1115108942 14:29797663-29797685 GCAGGTGCTTCGAGGTTCCCTGG - Intronic
1115313861 14:32006275-32006297 GGAGGTGCTCCCAGGTGCCCAGG - Intergenic
1116676719 14:47915369-47915391 GCATGTGCTCCCTAGTTTTCTGG + Intergenic
1118683612 14:68268996-68269018 GCAGGGGGGCCCATCTTCTCAGG - Intronic
1118811866 14:69281030-69281052 GCAGCTGCTGCCCTGGTCTCGGG - Intronic
1118995921 14:70835882-70835904 GCAGGAGCTCTCATGTCCTCTGG - Intergenic
1120856802 14:89219543-89219565 GCATGTGGTGCCATGCTCTCGGG - Intronic
1121133592 14:91473243-91473265 GCAGTGGCTAGCATGTTCTCTGG + Exonic
1121348869 14:93157011-93157033 GGAGCTGCTCCCAGGGTCTCTGG - Intergenic
1122121922 14:99559091-99559113 GCAGGTGCTGCCATGCTTCCTGG + Intronic
1124139812 15:27067435-27067457 TAAGGTGATTCCATGTTCTCCGG - Intronic
1125164722 15:36689476-36689498 GAAGGTGCTCCTATTTTCTTAGG + Intronic
1128711428 15:69875147-69875169 GCAGATGCTCTCCTGGTCTCTGG + Intergenic
1129195553 15:73963648-73963670 GCACATGTTCACATGTTCTCAGG + Intergenic
1130760666 15:86816157-86816179 GTGGGTGTTCCCAAGTTCTCAGG - Intronic
1134250814 16:12572563-12572585 GGAGGTCCAGCCATGTTCTCTGG + Exonic
1134418984 16:14069304-14069326 CCAGTGGCTCCCAAGTTCTCAGG + Intergenic
1135827438 16:25741857-25741879 CCAGGGACTCACATGTTCTCTGG + Intronic
1136091415 16:27922910-27922932 GCCTGTGGTCCTATGTTCTCAGG - Intronic
1138448632 16:57079718-57079740 GGAGCTGCTCCCATCCTCTCTGG + Intronic
1139339243 16:66257183-66257205 GCAGGTGCTGACAAGTTCTTTGG - Intergenic
1140038892 16:71392268-71392290 GCATGTGCTCCCAGCTACTCAGG + Intergenic
1140515152 16:75535881-75535903 CCAGGAGCTCCCAGGTTCTCTGG - Intronic
1140921034 16:79538678-79538700 GCATGTGCCACCATGTTCCCAGG - Intergenic
1141092793 16:81141616-81141638 GCAGGTGGTCCCAGCTACTCGGG + Intergenic
1142636476 17:1260494-1260516 TGAGGGGCTCCCAAGTTCTCAGG + Intergenic
1143787152 17:9264427-9264449 ACATGTGGTCCCATCTTCTCAGG - Intronic
1146595970 17:34168956-34168978 GCATTCGTTCCCATGTTCTCGGG - Intronic
1146689475 17:34863287-34863309 GTAGATGCTCCCATCTTATCTGG - Intergenic
1147448085 17:40487241-40487263 GCAGCTGCTGGCATGTTCTTTGG + Exonic
1148156204 17:45426474-45426496 GCAGGAGCTCCTCTGTTCTGGGG + Intronic
1150387117 17:64770936-64770958 GCCTGTGGTCCCAGGTTCTCGGG + Intergenic
1151769057 17:76147767-76147789 GCAGGTGCCGCCATTTTGTCTGG + Intronic
1151937798 17:77273925-77273947 GCAGCTGCTACTGTGTTCTCTGG - Intergenic
1152330200 17:79668413-79668435 TCAGGTGCTCCTTTCTTCTCAGG - Intergenic
1152380386 17:79939300-79939322 GCAGGTACTTCCAAGTTCCCAGG - Exonic
1152420378 17:80189664-80189686 GCAGTTGCCGCCATCTTCTCGGG + Intronic
1153858962 18:9179638-9179660 GCAGGTGGTCCCAGCTACTCAGG - Intronic
1155602740 18:27568498-27568520 GCTGGTACTTCCATGGTCTCAGG - Intergenic
1157729868 18:49994140-49994162 GGAGGTGCTCCCCTAGTCTCGGG - Intronic
1160030208 18:75250581-75250603 GCAGGTGCTGCCATGGGCACTGG - Intronic
1160398057 18:78586378-78586400 GCAGGTGCTCACAGGACCTCAGG + Intergenic
1161019520 19:2001680-2001702 GCAGGTGCTCCGATACCCTCTGG + Intronic
1161427130 19:4209933-4209955 GCTGCTGGTTCCATGTTCTCAGG + Intronic
1162738856 19:12762356-12762378 GCAGGTGGTCCCAGCTACTCAGG + Intergenic
926163355 2:10503092-10503114 GCAGGTTTGCCCAAGTTCTCAGG - Intergenic
930036484 2:47088716-47088738 GCAGCTGATCTCATGTGCTCTGG - Intronic
931290313 2:60867356-60867378 GCAGATTCTCCCTGGTTCTCTGG - Intergenic
938779371 2:134571355-134571377 GCAGAAGCTCCCCTGTTCTGTGG - Intronic
940018054 2:149127493-149127515 GCAGGTGCTGCTAAGTCCTCTGG - Intronic
941081084 2:161061393-161061415 TCTGGTCCTTCCATGTTCTCTGG - Intergenic
942705074 2:178762080-178762102 TCAGAAGCTCCCATGTTCTTGGG - Intronic
944652082 2:201840774-201840796 GCAGGTGATCTCATTTTCTCTGG + Intronic
945271617 2:207946307-207946329 TCAGGTGTTCATATGTTCTCAGG - Intronic
946139627 2:217678669-217678691 GCAGGTTCTACCTTATTCTCTGG + Intronic
948176583 2:235948305-235948327 GCCTGTGGTCCCAGGTTCTCCGG - Intronic
1171359583 20:24577620-24577642 GGAGGTGCACTCATGTTCTCTGG - Intronic
1174457833 20:50662157-50662179 GCAGATGCTCCCAGGTAGTCTGG - Intronic
1174648462 20:52105071-52105093 GCCGGTGCTCAGAGGTTCTCCGG - Intronic
1175225113 20:57440074-57440096 GCAGGTGCTTCCAGGGTCTGTGG - Intergenic
1175703858 20:61161203-61161225 GCAGGAGCTCCCAAGATCTGTGG + Intergenic
1177037301 21:16060229-16060251 CCAGGTGCTACCATGTTCCCTGG - Intergenic
1182088318 22:27576602-27576624 GCTGGTGCTCCCAGGGTCTGAGG + Intergenic
1183584657 22:38745954-38745976 GCAGGTGCCCCCATTCTCTGAGG + Intronic
1183613551 22:38927408-38927430 GCCGGTGCTGCCATCTGCTCTGG - Intergenic
1184414121 22:44342266-44342288 GGAGGTGTTCCCATGGTCACAGG + Intergenic
1184915172 22:47564049-47564071 GCAAGCGCTGCCATGTTCTCGGG + Intergenic
1185100616 22:48839056-48839078 GCAGGTGCACTCCTGGTCTCTGG + Intronic
1185175510 22:49324256-49324278 GCAGCTGCTCACGTGCTCTCAGG + Intergenic
1185187432 22:49410287-49410309 CCAGGGGCTCCTGTGTTCTCAGG + Intergenic
949618839 3:5787243-5787265 GCAAGTGCTCTCTTGCTCTCTGG + Intergenic
950175433 3:10870158-10870180 GAAGGTGCTTCCAGGGTCTCCGG - Intronic
952361070 3:32630548-32630570 TCAGGTGTTCCCATTTTCCCAGG + Intergenic
954041507 3:47891437-47891459 GCAGGAGCTCCCAGTTTCCCAGG + Intronic
954207670 3:49072399-49072421 GCCTGTGGTCCCATGTACTCGGG + Intronic
955303889 3:57810107-57810129 CCAGGTGCCACCATGTTCCCTGG + Intronic
956110501 3:65865763-65865785 GCCGGTGATCCCAGGTACTCTGG - Intronic
956435707 3:69232664-69232686 GCAGGTGCACCCATTTGCTGGGG - Intronic
956666916 3:71650672-71650694 GCAGGTGCTCTCCTGTGCCCTGG + Intergenic
956885940 3:73559911-73559933 CTGGGTGCTCACATGTTCTCTGG - Intronic
960991378 3:123313823-123313845 TTTGGTGCTCCCATGTGCTCTGG - Intronic
961792076 3:129383509-129383531 GCAGGTGCCTCCCTGTTCCCAGG + Intergenic
964731723 3:159874319-159874341 GCAGCTGCTCAAAAGTTCTCTGG - Intronic
966325786 3:178752363-178752385 TCATATGCTCCCATGTTCCCAGG - Intronic
966499812 3:180626548-180626570 CCAGGCACTCCCATGTACTCTGG - Intronic
968555330 4:1244056-1244078 GCAGCAGCCCCCAGGTTCTCTGG + Intronic
968974828 4:3816578-3816600 GCAGGGGCTCCCTTGGTCACAGG + Intergenic
969548867 4:7850918-7850940 GCAGGTCCTACCAGGTGCTCAGG + Intronic
969648445 4:8448008-8448030 GCTGCTGCTCCCATCTTCCCAGG + Intronic
972935473 4:44129255-44129277 GCCTGTGCTCCCAGGTACTCGGG + Intergenic
974784024 4:66594065-66594087 GGAGGTGCTCCTACTTTCTCAGG + Intergenic
977265576 4:94849629-94849651 GCATGAGATCCCATCTTCTCTGG - Intronic
978218486 4:106238967-106238989 GCAGGTCCCACCAGGTTCTCAGG + Intronic
981076582 4:140598452-140598474 GGAAGTCCTGCCATGTTCTCTGG + Intergenic
981269179 4:142824067-142824089 CCAGGAGCTCCCATGTTCAAGGG - Intronic
981795433 4:148589907-148589929 CCAGGTGTTCCCATGGTCTTGGG - Intergenic
983144081 4:164190497-164190519 GCAGTTGCTCACATGTCTTCAGG + Intronic
991658950 5:68931330-68931352 GCCTGTCCTGCCATGTTCTCAGG + Intergenic
993283418 5:85958368-85958390 GCATGTAGTCCCATCTTCTCAGG + Intergenic
993626025 5:90225433-90225455 GCAGGTGATCTCATGATGTCAGG + Intergenic
994451656 5:99951228-99951250 CCAGGTGCCACCATGTTCCCCGG + Intergenic
997485506 5:134226942-134226964 ACAGGTGCATCCATCTTCTCTGG - Intergenic
998880071 5:146636545-146636567 CCAGTTCCTCCCATGTGCTCTGG - Intronic
999370396 5:151051782-151051804 GGGGGAGCTCTCATGTTCTCAGG + Intronic
1001957169 5:175855907-175855929 GCAGGTTGTCCTATTTTCTCTGG - Intronic
1002317025 5:178349968-178349990 GCATGTGCACCCAGGGTCTCGGG + Intronic
1003666124 6:8112978-8113000 GCAGCTTTTCCCAGGTTCTCTGG + Intergenic
1004513990 6:16306516-16306538 GCAGGCAATCCCATTTTCTCTGG + Exonic
1004915895 6:20331847-20331869 GCGTGTGCTCCCATCTTCACAGG - Intergenic
1005177718 6:23066117-23066139 GCAGGAGCTTCCTTGTTCTTGGG - Intergenic
1006909042 6:37552088-37552110 GCAGGAGCTTTCAAGTTCTCAGG + Intergenic
1008384462 6:50872644-50872666 GCAGCTGCTCCATTCTTCTCAGG + Intergenic
1018207240 6:161446934-161446956 GGAGCTGCTCCCATGTCCTGGGG - Intronic
1018566814 6:165163198-165163220 GAAGGGGCTCCCATGATCTTGGG + Intergenic
1019411590 7:909076-909098 GCAGCTGCTCCGGTGTTCTCGGG + Intronic
1020400618 7:7772720-7772742 GCAGCTGCGCCCGTTTTCTCTGG + Intronic
1021667239 7:22996166-22996188 GCAGGTGATCCCAGGTACTTGGG + Intronic
1023073403 7:36459776-36459798 GGAGGTGTTGCCATGTACTCTGG - Intergenic
1024027609 7:45426294-45426316 GCATATACTCCCATGTTCACCGG - Intergenic
1024156715 7:46633445-46633467 CCAGGTGCTCCTATGTTCAGAGG + Intergenic
1025914263 7:65853103-65853125 GCTTGTGGTCCCAGGTTCTCAGG - Intergenic
1027423957 7:78043472-78043494 GCAGCTGCTCCCTTGACCTCTGG + Intronic
1029608751 7:101615389-101615411 TCAGGTTCTCCCATGCTCCCAGG + Intronic
1031992965 7:128209822-128209844 GCAGGAGCTCCCGTGGTCACAGG - Intergenic
1032418409 7:131757086-131757108 GCAGCTACTCCCAGGTTCCCAGG - Intergenic
1032468474 7:132161598-132161620 GCTAGTGCTCCCAGGTTCCCCGG + Intronic
1034047725 7:147947501-147947523 GCCTGTGGTCCCAGGTTCTCAGG + Intronic
1037298155 8:17422988-17423010 TCAGGTGCTCCCATATTGTTAGG - Intergenic
1040385453 8:46912305-46912327 GCAGGTGCAGTCATGTTCACAGG + Intergenic
1041107649 8:54458283-54458305 GCCGGTGCTCCGCTGTTCGCCGG - Exonic
1042458260 8:69030786-69030808 GCAGCTGCTGCCATGCTCCCAGG + Intergenic
1042596096 8:70449784-70449806 ACAGGTGCTTTCCTGTTCTCTGG - Intergenic
1046382964 8:113474417-113474439 CCAGCTTCTCCCATGTTCTGAGG - Intergenic
1047479173 8:125264529-125264551 GCAGATGGTCCCAGGTACTCAGG - Intronic
1049018759 8:139939685-139939707 GCAAGTGCTCCCACCTTCTGTGG + Intronic
1049687095 8:143943366-143943388 GCAGGTGCCCTCATGCCCTCGGG - Intronic
1050757242 9:9020571-9020593 GCACGTGCTGCCATTTTCTGAGG + Intronic
1053139415 9:35673555-35673577 GCTGGGGCCCCCATGTCCTCTGG - Intronic
1053460152 9:38262455-38262477 GCACCTGCTCCCATGCTCTCTGG + Intergenic
1057501031 9:95596766-95596788 GCAGCTGCTCCCAGGGTCCCTGG + Intergenic
1060416607 9:123435134-123435156 GCAGGTGCTCCCATGTTCTCAGG - Intronic
1060803017 9:126556732-126556754 GCGGGTGCTCCCCCGTTCTGAGG + Intergenic
1061385385 9:130286541-130286563 GCAGGTGCTTCCGTGTTTCCAGG + Intronic
1062183272 9:135202571-135202593 GCTGGTGCCCCCAGGTCCTCAGG - Intergenic
1062248416 9:135582162-135582184 TCAGGTGCTGCCATCTTCACTGG + Intergenic
1062283807 9:135764125-135764147 GCAGGAGCTCCCATGGACTGTGG - Intronic
1193836177 X:86347370-86347392 GCAAGTGCACCCATGTGCTGAGG - Intronic
1194316223 X:92380133-92380155 CCAGGTGCCACCATGTTCCCTGG + Intronic
1195385859 X:104313183-104313205 AAAGGTGCTCCCATGCTCTCTGG - Intergenic
1199274269 X:145923480-145923502 GCAGATCCTCTCATGCTCTCAGG - Intergenic
1200624267 Y:5491706-5491728 CCAGGTGCCACCATGTTCCCTGG + Intronic
1200682996 Y:6235150-6235172 GCCTGTGGTCCCATGTACTCAGG - Intergenic
1200764746 Y:7070955-7070977 GCAGGTGGTCCCATGTACTCAGG + Intronic
1200832509 Y:7700731-7700753 GCCTGTGGTCCCATGTACTCAGG + Intergenic
1201049637 Y:9919231-9919253 GCCTGTGGTCCCATGTACTCAGG + Intergenic
1201262640 Y:12175574-12175596 CCAGGTGCTTCCAGGTTCTTGGG - Intergenic