ID: 1060418645

View in Genome Browser
Species Human (GRCh38)
Location 9:123451437-123451459
Sequence TAGGAGAGCACATCTGTTCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 134
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 126}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060418645_1060418646 -6 Left 1060418645 9:123451437-123451459 CCGGGAACAGATGTGCTCTCCTA 0: 1
1: 0
2: 0
3: 7
4: 126
Right 1060418646 9:123451454-123451476 CTCCTATTTTCACTCCGCTGTGG No data
1060418645_1060418649 28 Left 1060418645 9:123451437-123451459 CCGGGAACAGATGTGCTCTCCTA 0: 1
1: 0
2: 0
3: 7
4: 126
Right 1060418649 9:123451488-123451510 ACAAATAATGCATTTCCTATAGG No data
1060418645_1060418650 29 Left 1060418645 9:123451437-123451459 CCGGGAACAGATGTGCTCTCCTA 0: 1
1: 0
2: 0
3: 7
4: 126
Right 1060418650 9:123451489-123451511 CAAATAATGCATTTCCTATAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060418645 Original CRISPR TAGGAGAGCACATCTGTTCC CGG (reversed) Intronic
901227295 1:7621173-7621195 TATGAGAGGACCTCTTTTCCTGG - Intronic
903748045 1:25601936-25601958 TAGGAGAGCACATGTGCCTCGGG + Intergenic
905853294 1:41290210-41290232 TAGAAGAGAGCATCTTTTCCAGG - Intergenic
905890019 1:41513060-41513082 TTGGAGAGCACATGTGCTCGAGG + Exonic
907046247 1:51302045-51302067 TAGGAAAGCCCATCTGTTTAGGG - Intronic
907512870 1:54975317-54975339 AAGGAAAGAACATCTGTTCAAGG - Intergenic
907796113 1:57719410-57719432 TAGGAGACCACATCTGAACTTGG - Intronic
907950615 1:59179673-59179695 TATGAGGGAGCATCTGTTCCAGG + Intergenic
908834483 1:68214956-68214978 AAAGAGAGGACATCTCTTCCTGG + Intronic
908897631 1:68918317-68918339 GAGGAGAGCACAGCTTTTCCTGG - Intergenic
909796600 1:79747229-79747251 TATGACAGCACATCTGTTTATGG - Intergenic
911070617 1:93829224-93829246 TAGGAGAGCCAGTCTTTTCCTGG - Intronic
912921834 1:113875957-113875979 TAGGAAGGCCCATCTGCTCCTGG - Intergenic
913308068 1:117453049-117453071 GATGAGAGCACATCTGTTGATGG + Intronic
917170383 1:172166487-172166509 TGGCAGTGCACATTTGTTCCTGG - Intronic
920797630 1:209155817-209155839 CAGCAGAGCACAGCTGTCCCAGG + Intergenic
921171238 1:212551692-212551714 TAGGATACCACACCTGTCCCTGG - Intergenic
922806594 1:228393507-228393529 GTGGAGAGCCCATCTGTGCCTGG + Intergenic
1067085136 10:43234222-43234244 TAAGAGAGAACATCTGGGCCAGG + Intronic
1067913203 10:50368099-50368121 GAGGAGAGCACATCAGTTGATGG - Intronic
1070551613 10:77494829-77494851 TGTGAGGGCACATGTGTTCCAGG + Intronic
1076381649 10:130027934-130027956 GAGGAGAGCACAGCAGTACCTGG - Intergenic
1076544883 10:131238560-131238582 TAGGAAAGCACATAACTTCCAGG - Intronic
1083512047 11:63218555-63218577 TAGGAGAGAACTTGTGTTCATGG - Intronic
1084915940 11:72429088-72429110 AAGCAAAGCACATCTGTTTCTGG + Intronic
1085020306 11:73202487-73202509 TAGGAGAAAACAGCTGTTTCGGG - Intergenic
1085301502 11:75461588-75461610 TAGGAGACCACATCTCTAGCCGG - Intronic
1088489499 11:110372920-110372942 TAGGAGAACACCTCAGCTCCAGG + Intergenic
1089652591 11:119924059-119924081 TAGGAGAACACAGCTTTCCCAGG - Intergenic
1092551536 12:9507362-9507384 TCTGAGAGCACATCTGTATCTGG + Intergenic
1097583000 12:61481294-61481316 TGGGATACCACTTCTGTTCCTGG - Intergenic
1097967022 12:65592172-65592194 TAGGGAAGGAAATCTGTTCCTGG + Intergenic
1098889543 12:75995152-75995174 CAGGAGAGCACCACTGATCCAGG + Intergenic
1099061190 12:77911245-77911267 TAGGACAGATCATCTGTTTCTGG - Intronic
1113036148 13:106052001-106052023 TAGGACAGAACATCTGTTGCTGG - Intergenic
1119014966 14:71040920-71040942 TAAGTGAGAACATCTGTACCAGG + Intronic
1120480145 14:85039008-85039030 AATGAGAGAGCATCTGTTCCTGG - Intergenic
1122776902 14:104121242-104121264 TGGGACAGCACATCTGTCACAGG + Intergenic
1126711772 15:51465639-51465661 TAGAAGAGCCCAGCTGTTCAAGG + Exonic
1127615910 15:60685279-60685301 AAGGAGAGCACAGCGGATCCAGG - Intronic
1139801191 16:69524321-69524343 TAGGAAAGAATTTCTGTTCCTGG - Intergenic
1141374222 16:83514800-83514822 TCTGAGGGAACATCTGTTCCCGG - Intronic
1143039433 17:4022654-4022676 TAGGCCAGCACATCTGCACCAGG + Intronic
1143341184 17:6212528-6212550 TAGGAGAGGACTTCTGTGCTAGG - Intergenic
1143859643 17:9879352-9879374 TAGGTGTGCACAACTGTGCCTGG - Intronic
1144782683 17:17815849-17815871 TAAGAGAGCACCTGGGTTCCCGG + Exonic
1148797698 17:50205010-50205032 TAGAAGAGCAGAGCTGTACCTGG - Intergenic
1149153282 17:53594969-53594991 GAGGAGAGCATTTCTGTTGCTGG - Intergenic
1156360733 18:36382304-36382326 CACCAGAGCACTTCTGTTCCCGG + Intronic
1164533519 19:29066093-29066115 GAGCAGAGCAGATCTCTTCCTGG - Intergenic
1167236484 19:48318950-48318972 TAGGAATGCACCTCAGTTCCGGG + Intronic
1168327901 19:55547230-55547252 CATGAGAGCACCTCTGTCCCTGG - Intergenic
925364197 2:3300280-3300302 AAGGAGAGTACATGTGTTACAGG - Intronic
926536993 2:14125301-14125323 TAGGAAAAGACATCTATTCCTGG - Intergenic
927813959 2:26197730-26197752 TGGGAGAGCAGATGTGTTACTGG + Exonic
928642952 2:33319619-33319641 TGGGAGAGCGCAGTTGTTCCTGG - Intronic
929169954 2:38921701-38921723 TAGGTGAGCACCACTGTGCCTGG + Intronic
933164863 2:79064848-79064870 TACCAGGGCACATTTGTTCCTGG + Intergenic
933166706 2:79084703-79084725 GAGGAGAACACATCTGTTCTTGG - Intergenic
935934159 2:108163676-108163698 TATGAAAGCACCTGTGTTCCTGG - Intergenic
938073596 2:128320535-128320557 TAGGGGAGCACAGCTGCCCCGGG + Intergenic
938931579 2:136090817-136090839 TAGGAGAGCAGAAGTGTTCAAGG - Intergenic
946741283 2:222804416-222804438 TAGGAAAACACATATGTTCAAGG - Intergenic
1172816110 20:37687829-37687851 TAAGAGAGATCATCTTTTCCTGG - Intergenic
1173126013 20:40336664-40336686 TAGGGGAGAAATTCTGTTCCCGG + Intergenic
1173540085 20:43844470-43844492 TAGGAGAGCTGAGCTGTGCCGGG + Intergenic
1174114961 20:48220532-48220554 TAGTAAAGCACATTTGCTCCTGG + Intergenic
1174374296 20:50115184-50115206 TGGGAGAGGGCATGTGTTCCAGG - Intronic
1179185428 21:39082094-39082116 TATGACACTACATCTGTTCCAGG + Intergenic
1180368043 22:11958233-11958255 TACTAGATCACATCTGATCCTGG - Intergenic
1180957218 22:19746437-19746459 TAGGAGGGCCCATCAGATCCAGG - Intergenic
1181027383 22:20133833-20133855 TTGGAGGGCTCCTCTGTTCCTGG + Intronic
956001128 3:64731129-64731151 TAGGACAGCTCCTCTGTTCATGG + Intergenic
959849484 3:111071113-111071135 TCGGAGAGCACAGCTGTCCCGGG + Intronic
961633383 3:128317832-128317854 GAGGAGGGGACATCTGTGCCAGG - Intronic
964963149 3:162453785-162453807 AAGGAGATCACATCTGTTATTGG - Intergenic
971032454 4:22654553-22654575 TATGAAAGCACATTTTTTCCAGG - Intergenic
971392273 4:26197351-26197373 TGGTAGAGCACATCTGGACCGGG - Intronic
971451204 4:26803730-26803752 TTAGAGAGGAAATCTGTTCCTGG + Intergenic
972716420 4:41650845-41650867 CATGAGAGAGCATCTGTTCCAGG + Intronic
975890901 4:79025889-79025911 TAGGAAAGAAAATGTGTTCCTGG + Intergenic
977411754 4:96674978-96675000 TAGGAGAGGACACCTGTCTCTGG - Intergenic
978227906 4:106360801-106360823 TGTGAGAGAAGATCTGTTCCAGG - Intergenic
981931253 4:150191387-150191409 TAGGTTAGCAAACCTGTTCCAGG + Intronic
984397635 4:179221788-179221810 TCTGAGAGCGAATCTGTTCCAGG + Intergenic
988931543 5:36040081-36040103 TGGGAGAACACTTCTGTTGCAGG + Intronic
990580541 5:57163572-57163594 TGGGAGAGTACATGTGTTCCAGG + Intergenic
995391433 5:111644454-111644476 TAGGAGACCACATCTTTAGCTGG - Intergenic
999863076 5:155669322-155669344 GGGGAAAGCACATCTGTTACAGG - Intergenic
1000304371 5:159982358-159982380 CAAGAAAGCACATCTCTTCCTGG - Intergenic
1000389093 5:160704445-160704467 GAGGATAGCACATCTGTTTATGG - Intronic
1001531314 5:172463920-172463942 TAGGAGAGAACCACTATTCCTGG + Intergenic
1001853288 5:174988476-174988498 TAAGTGAGCACTTCTGTTTCTGG + Intergenic
1004856022 6:19750792-19750814 GAGGCGCGCCCATCTGTTCCAGG - Intergenic
1004953440 6:20701112-20701134 TAGGACACCAGATTTGTTCCTGG + Intronic
1006267984 6:32941302-32941324 TAGGAGAGGTTATCTGGTCCTGG - Intronic
1008739563 6:54589303-54589325 TAGGAAAGGACATCTGTAACTGG + Intergenic
1010057413 6:71582944-71582966 TAGGAAAGTGGATCTGTTCCAGG + Intergenic
1011518163 6:88175069-88175091 CAGCAGAGCACATCTGAACCAGG - Intergenic
1012804116 6:103873691-103873713 TTAGAAACCACATCTGTTCCTGG + Intergenic
1018312428 6:162525006-162525028 TAGGAAAGCATATTTGTTTCTGG - Intronic
1018559149 6:165083518-165083540 AAGGAAAGTCCATCTGTTCCAGG + Intergenic
1022635349 7:32127743-32127765 AAGAAGAACACATCAGTTCCTGG + Intronic
1022819685 7:33946751-33946773 TAGGAGAGTACATCTGCTTAAGG + Intronic
1025951947 7:66152355-66152377 TAGAAGAGCACAGCTGGCCCCGG + Exonic
1026206934 7:68265889-68265911 CAGTAGTTCACATCTGTTCCAGG + Intergenic
1026861709 7:73794406-73794428 TAGGAGAACACATGTGCACCTGG - Intergenic
1028670050 7:93391734-93391756 CAGGATAGGCCATCTGTTCCTGG - Intergenic
1028850837 7:95535485-95535507 TAGAAGAGCAGATCTGTGGCTGG + Intronic
1031921478 7:127604647-127604669 GATGACAGCACATCTGTTCATGG - Intergenic
1032115204 7:129111014-129111036 TAGGAGAGAAATTCTGTTCCAGG - Intergenic
1033849535 7:145478748-145478770 TAGGAGAACACCCCTTTTCCAGG + Intergenic
1034263339 7:149770470-149770492 TAGAAGAGGACATCTGCTCCTGG + Exonic
1034336700 7:150328519-150328541 CAGGGGTGCACATCTGATCCTGG - Intronic
1037575998 8:20203449-20203471 TGGGAGTCCACATCTGTGCCAGG + Intronic
1039970963 8:42321326-42321348 AAGGAGATCACATGTGCTCCTGG + Intronic
1041256764 8:55985442-55985464 GAGGATAGCAAATCTGTTTCAGG + Intronic
1050392335 9:5157818-5157840 TTGGTGAGCTCATGTGTTCCTGG - Intronic
1050473089 9:6013281-6013303 TCTGAGAGCACATCTGTATCTGG + Exonic
1052055022 9:23895587-23895609 AAGTAGAGCACATCTCTTCAAGG - Intergenic
1052094737 9:24370107-24370129 TAGGGGACCGCTTCTGTTCCTGG + Intergenic
1052554094 9:29990894-29990916 TAGGAGAAGACACATGTTCCTGG - Intergenic
1058746186 9:107993102-107993124 TATTAGAGAACATCTGTTTCTGG - Intergenic
1060418645 9:123451437-123451459 TAGGAGAGCACATCTGTTCCCGG - Intronic
1060451944 9:123750894-123750916 TAGGAGATTCCATCTGTTTCTGG + Intronic
1061507879 9:131042021-131042043 TAGGAGAGACCATCTAATCCAGG + Intronic
1061526329 9:131166960-131166982 TAAGAGAGCACCTTTGTTCTTGG - Intronic
1062524845 9:136974035-136974057 TAGGGGAGCAGATATGTCCCTGG - Intergenic
1190623390 X:52311740-52311762 TAATTGAGCACATGTGTTCCAGG + Intergenic
1192111084 X:68365506-68365528 GAGGAGAGCACAGCTGTTTGTGG - Intronic
1193982710 X:88203664-88203686 GTAGAGAGAACATCTGTTCCTGG - Intergenic
1196551368 X:117030234-117030256 AAGGAAAGTACATTTGTTCCAGG + Intergenic
1198871855 X:141184554-141184576 TTGGAGAGGACAGCAGTTCCAGG + Intergenic
1200764989 Y:7072894-7072916 TGGGAATGCACAACTGTTCCAGG - Intronic