ID: 1060419158

View in Genome Browser
Species Human (GRCh38)
Location 9:123455167-123455189
Sequence CTCCTTTAAGAACAGGACAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 204
Summary {0: 1, 1: 0, 2: 2, 3: 21, 4: 180}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060419158_1060419163 1 Left 1060419158 9:123455167-123455189 CCCATGTCCTGTTCTTAAAGGAG 0: 1
1: 0
2: 2
3: 21
4: 180
Right 1060419163 9:123455191-123455213 CGGCAGCGAGTCACTGCCAGAGG No data
1060419158_1060419164 2 Left 1060419158 9:123455167-123455189 CCCATGTCCTGTTCTTAAAGGAG 0: 1
1: 0
2: 2
3: 21
4: 180
Right 1060419164 9:123455192-123455214 GGCAGCGAGTCACTGCCAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060419158 Original CRISPR CTCCTTTAAGAACAGGACAT GGG (reversed) Intronic
900782912 1:4629493-4629515 CTCCTGCAGGGACAGGACATGGG - Intergenic
902702648 1:18183100-18183122 CTGCTTTTAGAACAGCACATAGG - Intronic
904309331 1:29617566-29617588 CTTCTTTCAGAACAGCATATTGG - Intergenic
904432529 1:30473847-30473869 CTCCTTTCTGCACAGGACACAGG - Intergenic
905473162 1:38207976-38207998 CTGCTTTCAGAGAAGGACATAGG - Intergenic
905577853 1:39060284-39060306 CTCCTGTAATACCAGCACATTGG + Intergenic
906611485 1:47206899-47206921 TTGCTTTAAGAACAGGACCTGGG + Intergenic
909803230 1:79841162-79841184 CTCCTTCAAGAAAAGCACAAAGG - Intergenic
910590746 1:88926315-88926337 CTCCCTTCAGGACAGGACACAGG + Intergenic
912877089 1:113371066-113371088 CTCTTTTAAGAATGTGACATTGG - Intergenic
914674172 1:149895615-149895637 CTGCTTTGAGACCCGGACATTGG - Intronic
916404541 1:164485046-164485068 CTCCTGGAAGAACATGACACTGG + Intergenic
916425909 1:164679457-164679479 CTCCTTTGAAAACAGGTGATGGG + Intronic
917334242 1:173912123-173912145 CTCCTTCAAGCACAGTACCTGGG + Intronic
917652206 1:177089032-177089054 CCCCTTTATGAGCAGGACAATGG + Intronic
918474442 1:184908174-184908196 TTGCTTTTAGAACAGGACTTGGG - Intronic
918569645 1:185974375-185974397 CTCTTTTAACAACATGAGATAGG + Intronic
921294422 1:213688679-213688701 TTCTTTTAAGAACAAGACAGAGG - Intergenic
923486335 1:234435090-234435112 CTGCTTAAAGAGAAGGACATAGG + Intronic
923734338 1:236589007-236589029 CTCCATTGATGACAGGACATAGG - Intronic
924820333 1:247483766-247483788 CACCTGTAAGAACAGCACTTCGG + Intergenic
1064165591 10:12982850-12982872 CGCCTTTAATAACAGCACTTTGG + Intronic
1064723662 10:18255525-18255547 CTCCTTGAAGGCAAGGACATTGG + Intronic
1068891789 10:62155662-62155684 CTCCTTTATGAAGAAGCCATTGG - Intergenic
1070142998 10:73752696-73752718 CTCCTTTAATACCAGCACTTGGG + Intronic
1074210318 10:111326674-111326696 CTCCATTAAAAACTGGACAAAGG - Intergenic
1075871725 10:125775879-125775901 CTCCTTAAGGAGCAGGACCTAGG + Intergenic
1076285700 10:129294320-129294342 TTCCTTTAATAACAAGACAAGGG + Intergenic
1078343907 11:10526157-10526179 TTCCTTTCAGCACAAGACATAGG + Intronic
1079355388 11:19726298-19726320 ATCCTATAGGAACAGGACAGGGG - Intronic
1081669671 11:44935973-44935995 CTCCTGACAGAACCGGACATGGG - Intronic
1081810096 11:45909654-45909676 CTCCCTTAGAAAAAGGACATCGG - Exonic
1082760676 11:57124131-57124153 CCCCTCTATCAACAGGACATGGG + Intergenic
1085777551 11:79380127-79380149 CTCCTTTTATAAAAGGACATTGG - Intronic
1086793725 11:91073532-91073554 CAACTTCAAGAACTGGACATTGG + Intergenic
1088741235 11:112769158-112769180 CTGCTTTAAGAGCAGGGCCTAGG - Intergenic
1088840534 11:113623952-113623974 CTACTTTAAGACCAGCACACTGG + Intergenic
1090277854 11:125432228-125432250 CTCCTTTAACAACAGGACAATGG + Exonic
1092509365 12:9138087-9138109 TTCCTTTAAGAACAGGAGCAAGG - Intergenic
1092882687 12:12900246-12900268 CTCTTTTAATGACAGGAGATGGG + Intronic
1093246438 12:16743741-16743763 CTCCTTTAAGAATGTGACTTAGG + Intergenic
1093833046 12:23789463-23789485 CTCCTTTAAGAATAGGCCAGAGG - Intronic
1095629916 12:44363701-44363723 CTTCTTTTAGAACAAAACATAGG - Intronic
1096196148 12:49649999-49650021 CTCCTAGAAGAACTGGACAGGGG + Intronic
1096554928 12:52397735-52397757 CTGTTTTAAGAAGAGGACAATGG - Intronic
1097796031 12:63862928-63862950 CTCCTCTAAGAACAGGGAATGGG - Intronic
1101683940 12:106998207-106998229 CTCATTATAGAACAGAACATAGG - Intronic
1108190770 13:47936627-47936649 CTGCTTTAAGAACAAATCATAGG + Intronic
1108415270 13:50192172-50192194 CCACTGTAAGAACAGGAAATGGG - Intronic
1113543324 13:111125719-111125741 CTACTTTAAGGACAGGACATTGG - Intronic
1113906983 13:113823876-113823898 CTCCTGAAACAAGAGGACATCGG - Intronic
1114851759 14:26390673-26390695 CTCCTTTAAAAACAGGAGAGTGG + Intergenic
1116175519 14:41465317-41465339 TTTCTTTAAGAATAGGATATGGG - Intergenic
1116403806 14:44543101-44543123 CTCACTTAAGCACAGTACATAGG - Intergenic
1117598586 14:57349627-57349649 CTTCTTTCAGAAGTGGACATGGG - Intergenic
1118442572 14:65825650-65825672 ATCTTTTAAGATCAGGAAATGGG - Intergenic
1118525543 14:66636960-66636982 CTACTCTTAGAACAGGATATAGG + Intronic
1120004339 14:79340010-79340032 CTTCTCTCAAAACAGGACATAGG - Intronic
1120536571 14:85703616-85703638 CTCCTTAAAGAACTGTACATTGG + Intergenic
1121912110 14:97801269-97801291 CTCCCTTGAGGACAGGAAATAGG + Intergenic
1125389060 15:39172280-39172302 CTCCTTCAAGAACAGGAGTGAGG + Intergenic
1125560287 15:40626429-40626451 CTCCTGTAATATCAGGACTTTGG - Intronic
1126155604 15:45563028-45563050 CTACATTAAGAAAGGGACATTGG + Intergenic
1128247450 15:66142832-66142854 CTCGCTTGAGAAGAGGACATGGG + Intronic
1129863683 15:78885027-78885049 CTCCTTCAGGAACAGGAAAAAGG - Exonic
1130200342 15:81820094-81820116 CTCTTATAAGAACATGTCATTGG + Intergenic
1132919122 16:2374600-2374622 CGCCTTCAAGTACTGGACATGGG + Intergenic
1134337727 16:13316800-13316822 CTCCTTCAAGAATAGGAAAGTGG + Intergenic
1138142239 16:54578708-54578730 CTCTTTTAAGACCAGGAAACAGG - Intergenic
1139277253 16:65739618-65739640 CTCCTCTCATAACAGGAAATGGG + Intergenic
1141755212 16:85986468-85986490 TTGCTTTAAGAACAGAGCATGGG + Intergenic
1146622512 17:34410224-34410246 CCCCTTTAAGAAGTGGACAAAGG + Intergenic
1150489577 17:65564971-65564993 CTGCTATAAGCACAGGACTTTGG - Intronic
1151423557 17:74014848-74014870 CTCCTTGGACATCAGGACATTGG + Intergenic
1152717984 17:81909033-81909055 CTCCTCTAGGAAAAGGACAACGG + Exonic
1154939628 18:21098489-21098511 TTCCTTTATGATCTGGACATAGG + Intronic
1156311376 18:35925487-35925509 CTACTTGAAGAACAGGACACTGG - Intergenic
1157277244 18:46320001-46320023 CTCCTTTAACCACAGTATATGGG - Intergenic
1159162751 18:64664971-64664993 CTTCTTAAAGAACATGAGATGGG + Intergenic
1161898925 19:7103277-7103299 TTCCATTAAGAACAATACATTGG + Intergenic
1162182804 19:8882232-8882254 TTCCTTTATGAAGAGGACATAGG + Intronic
1163147041 19:15387124-15387146 CTGCTTTATGAACAAGCCATGGG - Intronic
925004423 2:429969-429991 CTCTTTTATGAACGGGACGTGGG + Intergenic
925203125 2:1985025-1985047 CTCTTGCAGGAACAGGACATGGG + Intronic
925267408 2:2575826-2575848 CTCCATTAGGTAGAGGACATTGG - Intergenic
926777463 2:16436792-16436814 CTCATTTAAGAGCAGGTCACTGG + Intergenic
927329663 2:21847409-21847431 CTCCATTAAAAACTGGACAGAGG + Intergenic
929368201 2:41187737-41187759 CTCTGTAAAGAACAGGGCATGGG - Intergenic
932393837 2:71424162-71424184 ATCATTTAAGAAAAGGAAATGGG - Intronic
935086097 2:99846816-99846838 ATCCATAAAGAACATGACATAGG - Intronic
935402605 2:102675879-102675901 AACATTTAAGAACAGGAAATGGG - Intronic
935765229 2:106360014-106360036 CTCCTTTAATTCCAGGACTTTGG + Intergenic
937194379 2:120138269-120138291 CTCCTTTAAGATCTGGAAAAAGG + Intronic
937297786 2:120820199-120820221 CTCCCTTAAAATCAGGACAGTGG + Intronic
937542940 2:122981604-122981626 CTCACTTAAGAAAAGGACTTTGG - Intergenic
938641994 2:133290978-133291000 CTCCTGTAATCACAGCACATGGG - Intronic
939556977 2:143686686-143686708 CACATTTAAGCACAGGAAATTGG - Intronic
940801150 2:158134390-158134412 CTCCTCTAAGAACTGGAAATAGG + Intronic
943700441 2:190983541-190983563 CTCCCTTAACAACTGGCCATTGG + Intronic
944730730 2:202514868-202514890 CTCCTATAAGAACAGGAAACAGG - Exonic
945258183 2:207819847-207819869 GTCATCAAAGAACAGGACATGGG + Intergenic
946174607 2:217914782-217914804 CTCCTTAAAGAACAGCATTTAGG - Intronic
946769188 2:223070818-223070840 CTCATCTAAAAACTGGACATGGG - Intronic
947879815 2:233497900-233497922 CTTCTTAAAGAACAGGAAGTAGG + Intronic
948934222 2:241151745-241151767 CTCCTTGACTAACAGGACATGGG - Intronic
1170195547 20:13685401-13685423 CACCTTTAATACCAGCACATTGG + Intergenic
1173391394 20:42637681-42637703 CTCCTCTAAGAACAGGGACTTGG + Intronic
1175755626 20:61528023-61528045 ATCCTTTAAGAAAAGGAGCTGGG - Intronic
1178115562 21:29412919-29412941 CGCCTCTAAGAACAGGATATTGG + Intronic
1182369390 22:29800247-29800269 CTCCTCTGAGAACATGACATGGG - Intronic
1184423188 22:44393663-44393685 GTCCTTTGAGAACAGCTCATGGG + Intergenic
950767629 3:15284983-15285005 CTCCTTTATGCATAGTACATAGG + Intronic
951459275 3:22931920-22931942 CCCCTTGGAGAGCAGGACATAGG - Intergenic
952213079 3:31249030-31249052 ATCCTATAAGGACAGGCCATTGG - Intergenic
953831816 3:46304492-46304514 CTCCTATAACAAAAGCACATAGG - Intergenic
956268160 3:67421459-67421481 CTGCTTTAGGTACAGGACCTTGG + Intronic
959287232 3:104430561-104430583 CTTCTTTTTCAACAGGACATTGG - Intergenic
960300068 3:115992002-115992024 CCCCTTTCAAAACAAGACATTGG - Intronic
960354883 3:116639147-116639169 CTCCTTTAAGAAAATGTAATAGG + Intronic
963197943 3:142554486-142554508 CTCCTTTAACACCAGCACTTCGG - Intronic
963633727 3:147767205-147767227 CTGCTTTAGGCACAGGACAGAGG + Intergenic
964891142 3:161537043-161537065 CAACATTAAGAACAGAACATTGG + Intergenic
965153216 3:165010078-165010100 CTTCTTTATGAACAAGATATCGG + Intronic
965520579 3:169665319-169665341 CACCTTTATGCACAGGACAGCGG - Intergenic
965752553 3:171991027-171991049 TTCCTTTAAGAATATGTCATTGG - Intergenic
966200140 3:177353560-177353582 GTCCTTTGAGAACAGAAGATGGG - Intergenic
967090908 3:186134015-186134037 CTCCTTCAACACCAGGAAATTGG + Intronic
967326391 3:188244549-188244571 CTCCTTCAAGACCAAGACTTTGG + Intronic
967573750 3:191065119-191065141 CTCATTTAAGAAAAATACATGGG - Intergenic
969493068 4:7510851-7510873 CTCCTTTATTCACAGCACATTGG + Intronic
970472078 4:16388937-16388959 CTCCTTCAACAAGAGGATATGGG + Intergenic
982433673 4:155355158-155355180 CTCCTATAAGAACAAGAAAAAGG + Exonic
984416598 4:179468319-179468341 CTCATTTGAGAACGGGATATTGG + Intergenic
986412336 5:7493372-7493394 CTCCTCTAAGAAGAGGACAGGGG + Intronic
990798133 5:59567274-59567296 CACCTTTAGCAACTGGACATTGG - Intronic
991980022 5:72220790-72220812 CTGCTTTAAGAAAAGAAGATGGG + Intronic
992928202 5:81613649-81613671 CTCCTTTAAGAGTAGAACACTGG + Intronic
993032592 5:82722430-82722452 CTCCTATAAGAAAAGGAAAATGG - Intergenic
994332983 5:98529354-98529376 CTCATTTAAGAACAAGAGAATGG + Intergenic
995031945 5:107491136-107491158 CACCATTAGGGACAGGACATAGG + Intronic
996377502 5:122828816-122828838 TTCCTTTAAGAACCAGACATTGG + Intronic
999481619 5:151953722-151953744 GTCCTTTCTGAATAGGACATAGG + Intergenic
999959594 5:156740163-156740185 CAACTTTAAGAACATGATATTGG - Intronic
1000236691 5:159368073-159368095 CTCCCTTCAGGACAGGACAATGG + Intergenic
1003276888 6:4661026-4661048 CTCCTTTAAGAACAAGTGTTGGG - Intergenic
1006577009 6:35053882-35053904 CTCCCTTCAGAGCAGTACATCGG + Intronic
1009057472 6:58354573-58354595 CTCCTTTAAGAATCAGAGATGGG + Intergenic
1010762114 6:79735272-79735294 TTTCTTTAAAAACTGGACATTGG + Intergenic
1013921290 6:115407585-115407607 CTCCTTTAAGAAGTGGGCAAAGG - Intergenic
1015806336 6:137112829-137112851 CTGTTTTAAGAACATCACATCGG + Intergenic
1016177201 6:141095751-141095773 CTCCTATAATTTCAGGACATTGG + Intergenic
1016317109 6:142802388-142802410 GTCCAGTAAGAACAGGACACAGG + Intronic
1016341099 6:143061849-143061871 CTCCCTGGAGAACAGAACATGGG + Intronic
1016608455 6:145961759-145961781 CTCAGTTAAGAACTGGACAAAGG - Intronic
1017676483 6:156819796-156819818 CTCCTCTAAGGACATGACGTTGG + Intronic
1019395074 7:813739-813761 CTCATTTCAGAAGAGGACATTGG - Intergenic
1020148651 7:5664761-5664783 GTCCTTTAAGAACTGGACCCAGG - Intronic
1023109797 7:36798006-36798028 TCTCTTTAAGAACATGACATGGG + Intergenic
1023170924 7:37389721-37389743 CTCCTTTAACCATAGGAAATAGG + Intronic
1024717697 7:52099502-52099524 GTCCTTTATGAACAGTAAATAGG - Intergenic
1026639019 7:72108222-72108244 GTCCTTTAAGAGCAGGACAGAGG - Intronic
1027426602 7:78067787-78067809 TTCTTATCAGAACAGGACATTGG + Intronic
1027680623 7:81216277-81216299 GTACTGTAAGAACAGGACACAGG - Intergenic
1028938696 7:96494592-96494614 CTCCTCTTAGATTAGGACATGGG + Intronic
1031865931 7:127039291-127039313 TTCTTATAAGAACAGGAAATTGG + Intronic
1032286974 7:130546118-130546140 TCCCTTAAAAAACAGGACATTGG + Intronic
1032920539 7:136540905-136540927 TTTCATGAAGAACAGGACATAGG + Intergenic
1034522216 7:151629251-151629273 CTCTTGGAATAACAGGACATGGG - Intronic
1034998554 7:155593794-155593816 TTCCTTTAAGGGCAGGGCATAGG - Intergenic
1035561454 8:607356-607378 CTCTTTAAAGAAGAGGAGATGGG + Intergenic
1036027741 8:4928807-4928829 CTCCTGTAATCACAGGACTTTGG + Intronic
1039013397 8:33120755-33120777 CTGCCTTAAAAACAGGAAATTGG + Intergenic
1039725116 8:40207020-40207042 TTCCTTTAAGAACAGAAAAAGGG + Intergenic
1040357796 8:46636576-46636598 CTCCTTTATGGGCAGGACTTTGG - Intergenic
1041489465 8:58415939-58415961 CTCCAAGAAGAACAGGGCATTGG - Intronic
1041752712 8:61278480-61278502 CTGCTTTGAAAACAAGACATGGG - Intronic
1042156886 8:65853962-65853984 CTGCTTTAAGAAGATGGCATTGG + Intergenic
1042986554 8:74590265-74590287 CTCTTTTAAGAAAAATACATGGG - Intergenic
1047011755 8:120680134-120680156 CTGCTTTAAAAACAGAACTTTGG + Intronic
1049503089 8:142978525-142978547 AGACTTAAAGAACAGGACATTGG + Intergenic
1052338202 9:27340443-27340465 CTCATTTAACCACAGGAGATGGG + Intronic
1052461476 9:28769385-28769407 TTTCTTTAAGTACAAGACATTGG + Intergenic
1052466077 9:28831032-28831054 CTCCCTTAAGAAAAGGAAAATGG + Intergenic
1055603090 9:77940277-77940299 ATCCTTTAAAAATAGGACCTAGG + Intronic
1056537048 9:87537708-87537730 CTCCATTAAGAACAGATGATAGG - Intronic
1057072500 9:92112078-92112100 CTCCTTTAAGAAGACCACAGGGG + Intronic
1060161433 9:121369216-121369238 CCCCTCAAAGAACATGACATTGG - Intronic
1060419158 9:123455167-123455189 CTCCTTTAAGAACAGGACATGGG - Intronic
1187128168 X:16474139-16474161 CTACTTTTATAACAGGATATTGG - Intergenic
1188740631 X:33775182-33775204 TTCCTCTAAGAACAGGAAATAGG - Intergenic
1189421239 X:40860198-40860220 CTCCTCTGATAACAGGTCATAGG - Intergenic
1190238670 X:48639271-48639293 CTCCTTTAAGATCAGGAACAAGG + Intergenic
1194578290 X:95640474-95640496 CTCCTTTTAGCACAGCCCATTGG - Intergenic
1194738179 X:97539507-97539529 CTGCTTTTAGAAAATGACATAGG - Intronic
1199302159 X:146225313-146225335 CTTCTTTAAGAACATGAAACAGG - Intergenic
1199691965 X:150315376-150315398 CTCCTTGAAGATCAGGAGGTGGG - Intergenic
1200293816 X:154897170-154897192 CTTCTTAAAGAAGAGGTCATGGG + Intronic
1201234940 Y:11900182-11900204 ATCCTGTAAGAAGAGGAGATTGG - Intergenic
1201785750 Y:17776180-17776202 CTCCTGAAAGAAAAGGACTTAGG - Intergenic
1201815803 Y:18129808-18129830 CTCCTGAAAGAAAAGGACTTAGG + Intergenic
1201852516 Y:18502186-18502208 CTCCTGAAAGAAAAGGACTTAGG + Intergenic
1201880805 Y:18818198-18818220 CTCCTGAAAGAAAAGGACTTAGG - Intronic
1202329030 Y:23725592-23725614 CTCCTGAAAGAAAAGGACATAGG - Intergenic
1202541741 Y:25944462-25944484 CTCCTGAAAGAAAAGGACATAGG + Intergenic