ID: 1060419893

View in Genome Browser
Species Human (GRCh38)
Location 9:123460886-123460908
Sequence ACTATATGCTTCACGCAGGC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060419889_1060419893 19 Left 1060419889 9:123460844-123460866 CCTTTGTGCGATTATTTGACTAA No data
Right 1060419893 9:123460886-123460908 ACTATATGCTTCACGCAGGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060419893 Original CRISPR ACTATATGCTTCACGCAGGC CGG Intronic