ID: 1060421684

View in Genome Browser
Species Human (GRCh38)
Location 9:123473637-123473659
Sequence TTGTGTAGGAAGCAGTATGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060421677_1060421684 -3 Left 1060421677 9:123473617-123473639 CCTGGAACCACCCGTTCCTCTTG 0: 1
1: 0
2: 0
3: 10
4: 119
Right 1060421684 9:123473637-123473659 TTGTGTAGGAAGCAGTATGAGGG No data
1060421676_1060421684 -2 Left 1060421676 9:123473616-123473638 CCCTGGAACCACCCGTTCCTCTT 0: 1
1: 0
2: 0
3: 11
4: 148
Right 1060421684 9:123473637-123473659 TTGTGTAGGAAGCAGTATGAGGG No data
1060421679_1060421684 -10 Left 1060421679 9:123473624-123473646 CCACCCGTTCCTCTTGTGTAGGA 0: 1
1: 0
2: 0
3: 10
4: 93
Right 1060421684 9:123473637-123473659 TTGTGTAGGAAGCAGTATGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060421684 Original CRISPR TTGTGTAGGAAGCAGTATGA GGG Intronic
No off target data available for this crispr