ID: 1060422450

View in Genome Browser
Species Human (GRCh38)
Location 9:123479041-123479063
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060422442_1060422450 8 Left 1060422442 9:123479010-123479032 CCAGAATGGTAATGAATAAACCA 0: 1
1: 0
2: 0
3: 12
4: 205
Right 1060422450 9:123479041-123479063 CTCTCCTCTCAGAGAGGGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr