ID: 1060425505

View in Genome Browser
Species Human (GRCh38)
Location 9:123501574-123501596
Sequence AACCTTTGGGTACTGTTGAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 852
Summary {0: 1, 1: 0, 2: 18, 3: 127, 4: 706}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060425505 Original CRISPR AACCTTTGGGTACTGTTGAT GGG (reversed) Intronic
904292147 1:29493884-29493906 AACCTTTATGCACTGTTGGTGGG - Intergenic
905714659 1:40138259-40138281 AATCCTTGTGTACTGTTGATGGG + Intergenic
906570579 1:46834874-46834896 AACCCTTGTGCACTGTTGATGGG - Intergenic
906846930 1:49203151-49203173 AACTTTTGTGCACTGTTGGTGGG + Intronic
906863234 1:49384779-49384801 AAACTTTGTGCACTGTTGGTAGG + Intronic
906872340 1:49496981-49497003 AACATTTGCATACTGTTGGTGGG - Intronic
906903477 1:49863808-49863830 AACCCTTGTATACTGTTGGTGGG + Intronic
906997663 1:50814907-50814929 AACCCTTTTGTACTGCTGATGGG + Intronic
907178241 1:52545714-52545736 AACCTCTGTGCACTGTTGGTAGG + Intronic
907209691 1:52809628-52809650 AACCCTTGGACACTGTTGGTGGG - Intronic
907215069 1:52856071-52856093 AACCCTTGGACACTGCTGATGGG - Intronic
907452473 1:54554888-54554910 AACCTTTTGACACTGTTCATGGG - Intronic
907775880 1:57514296-57514318 AACCCTTGTATACTGTTGGTGGG - Intronic
907795974 1:57717449-57717471 AACTTTTAGGTACTGTTGGTGGG + Intronic
907935486 1:59037969-59037991 AACCCTTGTATATTGTTGATGGG + Intergenic
908301936 1:62770674-62770696 AACCCTTGAACACTGTTGATGGG - Intergenic
908376068 1:63542570-63542592 AACCCTTGTGCATTGTTGATAGG - Intronic
908440905 1:64153282-64153304 AACCATTGTGATCTGTTGATAGG + Intronic
908598680 1:65715506-65715528 AACCTTTGTACACTGTTGGTGGG - Intergenic
909705666 1:78580636-78580658 AACCCTTGTGCACTGTTGGTGGG - Intergenic
909818997 1:80034835-80034857 AACCCTTGAGCACTGTTGGTGGG - Intergenic
910783869 1:90972497-90972519 AACATTTGTGCACTGTTGGTGGG + Intronic
910980260 1:92953289-92953311 AACCCTTGTGTATTGTTGGTGGG + Intronic
911105230 1:94124739-94124761 AACCATTGTGCACTGCTGATTGG - Intergenic
911500465 1:98679457-98679479 AAACTTTGGGGACTGTTGGGAGG - Intronic
911600187 1:99840186-99840208 AATCTTTGTGCACTGTTGATGGG + Intergenic
911771654 1:101750784-101750806 AAACTTTTTATACTGTTGATGGG - Intergenic
911773593 1:101778969-101778991 AACCCTTGTGTGCTGTTGGTGGG - Intergenic
911961379 1:104307472-104307494 AACCCTTGTGCACTGTTGATGGG + Intergenic
911999785 1:104818297-104818319 ACCCTCTGGGTACTGTTGTGGGG - Intergenic
912127876 1:106562688-106562710 AACCCTTGTACACTGTTGATAGG + Intergenic
912406689 1:109444714-109444736 AAAATCTGGGTACTGTTGTTAGG + Intergenic
912877960 1:113381613-113381635 AACCCTTGTATACTGTTGATAGG - Intergenic
912918574 1:113842737-113842759 AATCCTTGTGTACTGTTGGTGGG + Intronic
913035186 1:114957814-114957836 AACCCTTGTTTACTGTTGCTGGG + Intronic
913174092 1:116257965-116257987 AAACCTTGTGCACTGTTGATGGG + Intergenic
913428544 1:118762390-118762412 AACCTTTGTATATTGTTGGTGGG + Intergenic
913458098 1:119054433-119054455 AACTCTTGTATACTGTTGATAGG + Intronic
914560693 1:148816393-148816415 AACCCTTGTACACTGTTGATGGG - Intronic
914612141 1:149313822-149313844 AACCCTTGTACACTGTTGATGGG + Intergenic
914935840 1:151979603-151979625 CACCTCTGGTCACTGTTGATAGG - Intergenic
915184230 1:154090872-154090894 AACCCTTGTGCACTGTTGGTAGG + Intronic
915382003 1:155450579-155450601 AACATTTGTACACTGTTGATGGG + Intronic
916286977 1:163118329-163118351 AACTCTTGTGCACTGTTGATGGG + Intronic
917125305 1:171682423-171682445 AACCCTTGTGCACTGTTGTTGGG - Intergenic
917211870 1:172639905-172639927 AACCTTTGGGCACATTTTATTGG - Intergenic
917919318 1:179736878-179736900 AACCTTTGTACACTGTTGGTTGG + Intergenic
918695259 1:187538640-187538662 AAAGTTTGGCTACTGTTCATAGG - Intergenic
918733516 1:188029189-188029211 AACCTTTGCAAACTGTTGGTGGG - Intergenic
919615616 1:199805183-199805205 AGCCTTTGGGTACTACTGATTGG + Intergenic
919962985 1:202491071-202491093 AACCCTTGTGCACTGCTGATGGG - Intronic
920192831 1:204204778-204204800 AACTCTTGTGTACTGTTGCTGGG - Intronic
921455121 1:215361884-215361906 AACCCTTGCACACTGTTGATGGG - Intergenic
921658834 1:217775107-217775129 AACCCTTGTGCCCTGTTGATGGG - Intronic
921980758 1:221256124-221256146 AACTTTTGTGCACTGTTGGTAGG + Intergenic
922056659 1:222048776-222048798 AACATTTGGGTAATTTTGCTGGG - Intergenic
922362830 1:224838806-224838828 AACCTTTGGCCACAGTTGGTTGG + Intergenic
922737057 1:227992194-227992216 AACCTTTATGCACTGTTGGTGGG + Intergenic
922996714 1:229969981-229970003 AACCCTTGTGTGCTGTTGGTGGG + Intergenic
923011301 1:230090004-230090026 AACCCTTGTGTACAGTTGGTGGG - Intronic
923175450 1:231459714-231459736 AATCTTTGTACACTGTTGATGGG + Intergenic
923177543 1:231481720-231481742 AACCCTTGTGTACTGTTGATGGG - Intergenic
923378410 1:233390014-233390036 AACCTATGGGATCTGATGATAGG + Intergenic
923421504 1:233820471-233820493 AACCTTTGTGCACTGTTGGTAGG - Intergenic
923440592 1:234016177-234016199 AACCCTTGTGCACTGTTGATGGG + Intronic
924393464 1:243589563-243589585 AACCCTTGTGCACTGTTGGTGGG + Intronic
924488046 1:244506505-244506527 AACCTTTGTGTACTGTTAATGGG - Intronic
924649065 1:245906522-245906544 AACCCTTGTACACTGTTGATGGG + Intronic
924813052 1:247420020-247420042 AACCCTTGTGTGCTGTTGGTGGG - Intronic
1062869354 10:886339-886361 AACCTTTGCACACTGTTGGTGGG + Intronic
1063640544 10:7825957-7825979 AACCCTTGGGCACTGCTGATAGG - Intronic
1063691825 10:8295195-8295217 AACCATTGGGTGCTGTGGGTAGG - Intergenic
1063699902 10:8374207-8374229 AACCCTTGTGTACTGTTGGTGGG - Intergenic
1064510753 10:16088192-16088214 AACTTTTGTATACTGTTGGTGGG + Intergenic
1064618995 10:17194997-17195019 AACCCTTATGCACTGTTGATGGG + Intronic
1065090066 10:22222930-22222952 AACCTTTGTGCACTGTTGATGGG - Intergenic
1065194144 10:23245734-23245756 AACCCTTGCACACTGTTGATGGG + Intergenic
1065200247 10:23305707-23305729 AACCCTTGTGCACTGTTGATGGG + Intronic
1066013104 10:31212279-31212301 AAGCCTTGTGTACTGTTGATGGG + Intergenic
1066968025 10:42287920-42287942 AGCCTTTGTATACTGTTGGTGGG - Intergenic
1067016774 10:42762558-42762580 AACCCTTGCATACTGTTGGTGGG - Intergenic
1067032476 10:42887562-42887584 AACCCTTGTCTACTTTTGATGGG - Intergenic
1067161605 10:43830069-43830091 AACCTTTGTAAACTGTTGGTGGG + Intergenic
1067174371 10:43932451-43932473 AACCCATGTGCACTGTTGATGGG - Intergenic
1068040799 10:51821833-51821855 AATCTTTATGCACTGTTGATGGG + Intronic
1068363948 10:56019259-56019281 AACCGTTGTGTACTGTTGGCAGG + Intergenic
1068697796 10:59986851-59986873 AACCCTTGTACACTGTTGATGGG - Intergenic
1070097614 10:73353258-73353280 AACCTTTGGCTGTTGTTGATGGG - Intronic
1070377497 10:75847942-75847964 AACCCTTGTGTACTGTTGGAAGG + Intronic
1070508184 10:77135371-77135393 AACCCTTGCATACTGTTGATGGG + Intronic
1070843477 10:79503930-79503952 ACCCTTTGGGTAGTGTTGACTGG - Intergenic
1070930188 10:80255670-80255692 ACCCTTTGGGTAGTGTTGACTGG + Intergenic
1071433505 10:85625297-85625319 GGCCTTTGTGTCCTGTTGATGGG - Intronic
1071605835 10:86988097-86988119 AACCCTTGCATACTGTTGGTGGG - Intergenic
1072078518 10:92003859-92003881 AACCCTTGCGTATTGTTGGTGGG - Intronic
1072366230 10:94712799-94712821 AACACTTGTGTACTGTTGATGGG - Intronic
1072678348 10:97485855-97485877 AACCTTTGTACACTGTTGGTGGG + Intronic
1073613204 10:104965529-104965551 AACCCTTGTGAACTGTTGGTGGG - Intronic
1073884830 10:108026558-108026580 AACCCTTTTGCACTGTTGATGGG + Intergenic
1074036571 10:109745119-109745141 AGACTTTGGGTACTCTTGTTTGG + Intergenic
1074304086 10:112260504-112260526 AACCTTTGTACACTGTTGGTGGG + Intergenic
1074494333 10:113966355-113966377 AATCTTTGTGCACTGTTGATGGG - Intergenic
1074634673 10:115301309-115301331 AACCTTTGTGCACTGCTGGTGGG - Intronic
1075353742 10:121751424-121751446 AACCTTTGTATACTGCTGGTGGG - Intronic
1075917239 10:126179165-126179187 AAACTTTGGGCACAGCTGATGGG - Intronic
1075968642 10:126634010-126634032 AACCTTTGCACACTGTTGGTGGG + Intronic
1076050633 10:127330463-127330485 AACCCTTGTGTACTGTTGCTGGG + Intronic
1076178333 10:128385933-128385955 AACCCTTGTGCACTGTTGGTGGG + Intergenic
1076593159 10:131605161-131605183 AAACCTTGTGTACTTTTGATGGG + Intergenic
1077564796 11:3290717-3290739 AGCCATTGGGTAGTGTTGACTGG - Intergenic
1077570686 11:3336534-3336556 AGCCGTTGGGTAGTGTTGACTGG - Intergenic
1077940574 11:6837023-6837045 AACCCTTGTGCACTGTTGGTGGG - Intergenic
1077952532 11:6975959-6975981 AACCCTTGTATACTGTTGATGGG - Intronic
1078311260 11:10245527-10245549 ACCCTTTGTATACTGTTGGTGGG + Intronic
1078490782 11:11766344-11766366 AACCCTTGTGTACTATTGATGGG + Intergenic
1078813001 11:14789576-14789598 TACCTTTGGATACTATTCATTGG - Intronic
1079736469 11:24003023-24003045 AACCCTTGTGTACTGTTGCTGGG + Intergenic
1081120684 11:39261903-39261925 AACCCTGGTATACTGTTGATGGG + Intergenic
1082053531 11:47793427-47793449 AACCCTTTTGTACTGTTGCTGGG + Intronic
1082745101 11:56952426-56952448 AACCCTTGTGTACTGTTGGTGGG + Intergenic
1082935968 11:58657042-58657064 AACCCTTGTGCACTGTTAATGGG - Intronic
1082954653 11:58857132-58857154 AACCCTTGTGCACTGTTGGTGGG - Intronic
1082971706 11:59029823-59029845 AACCCTTGTGTACTGTTGGTGGG - Intronic
1083030532 11:59587708-59587730 AACCTTTGTGCACTGTTGGTGGG + Intronic
1083079581 11:60076709-60076731 AACCCTTGTGCACTGTTGGTAGG + Intergenic
1083127575 11:60586984-60587006 AACCTTTGTACACTGTTCATGGG + Intergenic
1085071176 11:73547385-73547407 AACCCTTGTGTGCTGTTGGTGGG + Intronic
1085106922 11:73852627-73852649 AACCTTTATACACTGTTGATGGG + Intronic
1085234303 11:75001069-75001091 AACCACTGTGTACTGTTGGTAGG - Intronic
1087090284 11:94263323-94263345 AACCCATGTGAACTGTTGATGGG - Intergenic
1087517941 11:99189495-99189517 AACCTTTGCATAGTGTTGGTAGG - Intronic
1087654586 11:100907093-100907115 AACCCTTAGGTACTACTGATGGG - Intronic
1088865585 11:113844781-113844803 AAACTTTGTGCACTGTTGGTGGG + Intronic
1089157067 11:116410609-116410631 CACCTCTAGGAACTGTTGATGGG - Intergenic
1089841582 11:121423460-121423482 AACCTTTGTGCAATCTTGATGGG - Intergenic
1089935639 11:122361263-122361285 AACCTTCGTGCACTGTTGGTGGG - Intergenic
1090761805 11:129843825-129843847 AACCTTTACATACTGTTGGTGGG + Intronic
1091578974 12:1769091-1769113 TATCTTTGGGTACTGTGGTTTGG + Intronic
1091594562 12:1867995-1868017 AACCTTTGTACACTGTTGGTGGG + Intronic
1092397395 12:8139820-8139842 AACCTTTGTGCTCTGTTGGTGGG - Intronic
1092404842 12:8213243-8213265 AACCTTTGTATACTGGTGGTGGG - Intergenic
1092452613 12:8617110-8617132 AACCTTTGTACACTGTTGGTGGG - Intergenic
1093115328 12:15202909-15202931 AATCCTTGTATACTGTTGATGGG - Intronic
1093410255 12:18856747-18856769 AACCCTTGTGTACTGCTGATGGG + Intergenic
1093850510 12:24031073-24031095 AACCCTTGCATACTGTTGGTGGG + Intergenic
1093891264 12:24524697-24524719 AACTTTTGTACACTGTTGATGGG + Intergenic
1094215642 12:27939260-27939282 AACCCTTGGGCACTGTTGGTGGG + Intergenic
1094586121 12:31778866-31778888 AACATTTGGCTACATTTGATTGG + Intergenic
1095363754 12:41376336-41376358 AACCCTTGTGCATTGTTGATGGG - Intronic
1095643455 12:44512358-44512380 AACCCTTGTGCACTGTTGGTGGG + Intronic
1095823869 12:46510710-46510732 AACCTTTACACACTGTTGATGGG - Intergenic
1096040786 12:48514735-48514757 AACCTTTGTACATTGTTGATGGG - Intronic
1096752813 12:53773097-53773119 AACCTTTGTGTACTGCTGGTTGG + Intergenic
1097509983 12:60527415-60527437 AACCCTTGTATACTGTTGCTGGG - Intergenic
1097669121 12:62515017-62515039 AACCCTTGTGCACTGTTGGTGGG + Intronic
1097695335 12:62769656-62769678 AACCCTGAGGGACTGTTGATGGG + Intronic
1097742145 12:63255706-63255728 AACCCTTGTTCACTGTTGATGGG + Intergenic
1097763694 12:63498743-63498765 AACCCTTGTATACTGTTGTTGGG - Intergenic
1098385358 12:69912913-69912935 AATCTTTGGGAACTGTTGGTGGG - Intronic
1098508747 12:71285876-71285898 AACCTTTGAATACTGTTGATGGG - Intronic
1098798948 12:74928479-74928501 AAACCTTGAATACTGTTGATGGG + Intergenic
1098823661 12:75266452-75266474 AACCTTTGCACACTGTTGGTGGG + Intergenic
1098867745 12:75782113-75782135 AACTTTTGTGCACTGTTTATTGG + Intergenic
1099391368 12:82083665-82083687 AACCCTTGTATACTTTTGATGGG - Intergenic
1100400946 12:94229014-94229036 AACCCTTGTGCACTGTTGGTGGG - Intronic
1100424313 12:94469055-94469077 AATCCTTGTGCACTGTTGATGGG + Intergenic
1100701116 12:97149411-97149433 AGCCCTTGGGTCCTGGTGATGGG + Intergenic
1100755309 12:97744909-97744931 AACCTTTGTACACTGTTGGTGGG + Intergenic
1100996819 12:100309872-100309894 AATCTTTGTGTACTGTTGGTGGG - Intronic
1101080824 12:101182323-101182345 AACATTTGGGAAGTGTTTATGGG + Intronic
1101210688 12:102532571-102532593 AACCTTTGTGCACTGCTGGTGGG + Intergenic
1101414272 12:104495430-104495452 AACCCTTGTGTACTGTTGGTAGG - Intronic
1101527158 12:105541678-105541700 AACCCTTGTATACTATTGATAGG - Intergenic
1101595664 12:106162665-106162687 AACCCTTGTGCACTGTTGGTGGG - Intergenic
1102246127 12:111357215-111357237 AACCCTTGTGCACTGTTGGTGGG - Intergenic
1102659777 12:114515825-114515847 AACCTTTGTACACTGTTGGTGGG + Intergenic
1105237954 13:18578495-18578517 AACATTTCTGTACTGTTGGTGGG + Intergenic
1105379983 13:19877989-19878011 AACCCTTGTGCACTGTTGGTGGG - Intergenic
1105726495 13:23167511-23167533 AACCCTTGTGCACTGTTGGTGGG - Intergenic
1105755927 13:23464316-23464338 ATCCCTTGTGTACTGTTGGTAGG + Intergenic
1105972462 13:25442356-25442378 AACCTTTGAGCACTGTTGGTGGG - Intronic
1106309507 13:28541849-28541871 AACCCTTGTGCACTGCTGATGGG - Intergenic
1106626852 13:31429453-31429475 AACCTTTGCACACTGTTGATGGG - Intergenic
1106668653 13:31880875-31880897 AACCCTTGTGTACTGCTGGTGGG + Intergenic
1106799231 13:33239488-33239510 AACACTTGTGTATTGTTGATGGG - Intronic
1106974303 13:35188840-35188862 AACCCTTGCACACTGTTGATAGG - Intronic
1107134397 13:36927821-36927843 AACCCTTGTGCACTGTTGGTGGG - Intergenic
1108010443 13:46002296-46002318 AACACTTGTGTACTGTTGGTGGG + Intronic
1108135614 13:47354670-47354692 AACCCTTGCATACTGTTGGTGGG - Intergenic
1108411436 13:50151632-50151654 AATCTTTGTGCACTGTTGGTGGG - Intronic
1108896662 13:55336925-55336947 AACTTTTGTTTACTGTTGATGGG - Intergenic
1109400788 13:61825638-61825660 AACCTTAGTGCACTGTTGGTGGG - Intergenic
1110313616 13:74079760-74079782 AACTCTTGTGTACTGTTGGTAGG + Intronic
1110692411 13:78446174-78446196 AGCCTTTGTGTACAGTTGTTTGG + Intergenic
1110976359 13:81840648-81840670 AACCCTTATGTACTGTTGGTGGG + Intergenic
1111022332 13:82468251-82468273 AACGCTTGTGTGCTGTTGATGGG - Intergenic
1111330204 13:86756098-86756120 AACCTTAGGGAACTGTTTATGGG - Intergenic
1111424135 13:88057561-88057583 ACCCTTTGTATACTGTTGGTGGG - Intergenic
1112014475 13:95320100-95320122 AAACTTTGTGCACTGTTGACGGG + Intergenic
1112081491 13:95976534-95976556 AACCCTTGTGCACTGTTGGTGGG - Intronic
1112815877 13:103272490-103272512 AACCTTTGCATACTGTTGGTGGG + Intergenic
1112974675 13:105302920-105302942 AAACTTTTGTTGCTGTTGATAGG + Intergenic
1113353901 13:109559296-109559318 AACTCTTGTGTACTGTTGATGGG + Intergenic
1113469718 13:110535772-110535794 GAGCTTTGGGTACTGCTGCTGGG - Intronic
1114068464 14:19087555-19087577 AACCCTTGCATACTGTTGGTGGG + Intergenic
1114093799 14:19312459-19312481 AACCCTTGCATACTGTTGGTGGG - Intergenic
1114275756 14:21142548-21142570 AACCCTTGTGCACTGTTAATGGG - Intergenic
1114561214 14:23592123-23592145 AATCTTTGTGCACTGTTGGTAGG - Intergenic
1115352983 14:32416155-32416177 AACCTTTGTGCATTGTTGGTGGG - Intronic
1115691781 14:35851682-35851704 AACCCCTGTGTACTGTTGGTGGG + Intronic
1115898317 14:38116122-38116144 AACCCGTGTGTACTGTTGGTGGG + Intergenic
1116074778 14:40097246-40097268 AACCTTTATATATTGTTGATAGG - Intergenic
1116481690 14:45398634-45398656 AACCTTTGCACACTGTTGGTGGG + Intergenic
1116555623 14:46301659-46301681 CACCTTTGGAAAATGTTGATTGG + Intergenic
1116633307 14:47360603-47360625 AACCTTTGTATACTGTTGGTGGG + Intronic
1116844699 14:49854156-49854178 AACTTTTGTATGCTGTTGATGGG + Intergenic
1116853831 14:49934240-49934262 AACCCCTGTGCACTGTTGATGGG - Intergenic
1116906134 14:50405392-50405414 AACCCTTGTATACTGTTGGTGGG - Intronic
1117003009 14:51390761-51390783 AACCCTTGTGTACCGTTTATTGG + Intergenic
1117054724 14:51900121-51900143 AGCCCTTGGGTACTGTTGGGGGG - Intronic
1117232339 14:53733489-53733511 AACCCTTGTACACTGTTGATGGG + Intergenic
1117381762 14:55171500-55171522 AACCCTTGTATGCTGTTGATGGG + Intronic
1117398326 14:55334512-55334534 AGCCATTGGGTAATATTGATGGG + Intronic
1117477699 14:56113801-56113823 AATCTTTGTGTATTGTAGATGGG + Intergenic
1118019910 14:61700742-61700764 AACCCTTGTGCACTGTTGGTGGG - Intronic
1118114245 14:62757322-62757344 AACCCTTGTATACTGTTGGTCGG + Intronic
1118127716 14:62927267-62927289 AACCCTTGTGCACTGTTGGTGGG + Intronic
1118436810 14:65778994-65779016 AACTCTTGTGTACTGTTGGTGGG - Intergenic
1118526162 14:66646352-66646374 AACCTTTGTGTATTGTTGGTGGG + Intronic
1119056215 14:71422938-71422960 AATCTTTGTGCACTGTTGGTAGG - Intronic
1119058651 14:71450783-71450805 AACCCTTGCATACTGTTGGTGGG + Intronic
1119342864 14:73895297-73895319 AACCTTTGTACACTGTTGGTGGG + Exonic
1119941576 14:78646947-78646969 AACCTTTTGCTAGTTTTGATTGG + Intronic
1120304757 14:82755058-82755080 AACATTGGTATACTGTTGATGGG + Intergenic
1120352851 14:83385750-83385772 AACCCTTGGGCACTGTTGGTGGG - Intergenic
1121721107 14:96109251-96109273 AACCTGTGGGAAGTGTTGGTGGG - Intergenic
1123462559 15:20486600-20486622 AACCCTTGTGCACTGTTGGTGGG - Intergenic
1123655502 15:22513802-22513824 AACCCTTGTGCACTGTTGGTGGG + Intergenic
1123917582 15:25048284-25048306 AACCTTTGCATGCTGTTGATGGG - Intergenic
1124034371 15:26040637-26040659 AACCCTTGTATACTGTTGGTGGG - Intergenic
1124056693 15:26246935-26246957 AACCTTTGTGCACTGTTGGTGGG - Intergenic
1124199263 15:27663264-27663286 AACCTTTGCATACTGTTGGTGGG + Intergenic
1124273246 15:28302620-28302642 AACCCTTGTGCACTGTTGGTGGG - Intronic
1124309409 15:28608997-28609019 AACCCTTGTGCACTGTTGGTGGG + Intergenic
1124359164 15:29022251-29022273 AATCCTTGTGCACTGTTGATAGG - Intronic
1124432832 15:29621648-29621670 AACCCTTGTGCACTGTTGGTAGG + Intergenic
1124491274 15:30157831-30157853 AACACTTTTGTACTGTTGATGGG - Intergenic
1124843461 15:33266465-33266487 AACCTTTGTACACTGTTGGTAGG - Intergenic
1125060952 15:35423171-35423193 AACCCTTGTATACTGTTGGTGGG - Intronic
1125456018 15:39859547-39859569 AACCTTTGTGCACTGTTGGTGGG + Intronic
1125700389 15:41677559-41677581 AACACTTGTGCACTGTTGATGGG - Intronic
1125772663 15:42180898-42180920 AACCCTTGCGCACTGTTGGTGGG + Intronic
1126392510 15:48174817-48174839 AACCTTTAGATACTGCTGGTGGG + Intronic
1127316598 15:57800812-57800834 AACCCTTGCGTACTGTTGATGGG - Intergenic
1128007110 15:64253451-64253473 AACCCTTGTGCACTGCTGATGGG + Intronic
1128048979 15:64645912-64645934 AACCCTTGAGAACTGTTGGTTGG + Intronic
1128299392 15:66556032-66556054 AACCCTTGTGTATTGTTGCTGGG + Intronic
1128884376 15:71272924-71272946 AACCTTTGTCTACCGTTGGTGGG + Intronic
1129541719 15:76355285-76355307 AGCCTTTAGAGACTGTTGATAGG + Intronic
1129587266 15:76880934-76880956 AACCCTTGTGCACTGTTGGTGGG + Intronic
1130536541 15:84789544-84789566 AACACTTGGGCACTGTTGGTGGG - Intronic
1131135361 15:89930504-89930526 AACCCTTGTGCACTGTTGGTGGG + Intergenic
1131288681 15:91085154-91085176 AAGCTTTGTATACTGTTGTTTGG - Intergenic
1132671978 16:1105781-1105803 AACCTTTGGCCACTGCTGCTTGG - Intergenic
1133238233 16:4399017-4399039 AACCCTTGCACACTGTTGATGGG + Intronic
1133642415 16:7730115-7730137 AACCTTTGTATACTGTTGGTGGG + Intergenic
1133884734 16:9815657-9815679 AACCCTTGTGCACTGTTGGTGGG + Intronic
1134796701 16:17045453-17045475 AACCCTTGTATACTGTTGATGGG - Intergenic
1134864680 16:17594451-17594473 AACCCTTGGGTACTGTTGGTGGG - Intergenic
1135617008 16:23920110-23920132 AATCCTTGTGCACTGTTGATGGG - Intronic
1136493719 16:30628098-30628120 AACTCTTGTGCACTGTTGATGGG + Intergenic
1137534808 16:49312051-49312073 AACCCTTGTGCACTGTTGGTAGG - Intergenic
1137637334 16:49998275-49998297 AACCTTTGGGTACCCTGGGTGGG - Intergenic
1137667025 16:50256739-50256761 AACCCTTGAGCACTGTTGGTGGG + Intronic
1137693181 16:50443700-50443722 AACTCTTGTGTACTGTTGGTGGG + Intergenic
1138920392 16:61521485-61521507 AACCCTAGGGCACTGTTGGTGGG + Intergenic
1139142346 16:64281897-64281919 AAGCTTTGTGCACTGTTGGTGGG + Intergenic
1139352956 16:66348798-66348820 AAGCCTTGTGCACTGTTGATGGG + Intergenic
1139363870 16:66421393-66421415 ACCCTTTGGTCACAGTTGATTGG + Intergenic
1140100601 16:71913218-71913240 AACCCTTGTGCACTGTTGGTGGG - Intronic
1140331037 16:74057055-74057077 AACCCTTGGGCACTGTCGGTGGG + Intergenic
1140333957 16:74085870-74085892 AACCTTTGCACACTGTTGATGGG - Intergenic
1140576149 16:76171600-76171622 AACCTTTGTTCACTGTTGTTGGG - Intergenic
1140867533 16:79077032-79077054 AACCTTAGGGAATTGATGATCGG - Intronic
1141011107 16:80400526-80400548 AACCCTTGTATACTGTTGGTGGG + Intergenic
1141350927 16:83295703-83295725 AACCCTTGCCCACTGTTGATGGG + Intronic
1144009393 17:11131945-11131967 AACCCTTGTATACTGTTGGTGGG - Intergenic
1144174985 17:12696528-12696550 CACCCTTGTGCACTGTTGATGGG - Intronic
1146090948 17:29877253-29877275 AACCCTTGTAAACTGTTGATCGG + Intronic
1146606431 17:34262244-34262266 AATCTTTGTTTACTGTTGGTGGG - Intergenic
1148223613 17:45882637-45882659 AACTTTTGGGTAGTGGTGAATGG - Intergenic
1148361083 17:47012757-47012779 AACCTTCATATACTGTTGATGGG + Intronic
1148586063 17:48781409-48781431 AATCTTTCTGCACTGTTGATGGG - Intronic
1148986169 17:51623612-51623634 AACCTTTGTACACTGTTGATGGG + Intergenic
1149663451 17:58349086-58349108 AACCTTTGGGCACTGTTGGTGGG + Intronic
1149689640 17:58564065-58564087 AACCCTTGTGCACTGTTGGTGGG + Intronic
1149900229 17:60469986-60470008 AAACTTTGTGCACTGTTGCTGGG - Intronic
1150269303 17:63852628-63852650 AATCTTTTGGTTCTGTTGAGGGG - Intergenic
1150986183 17:70199702-70199724 AACATTTGTATACTGTTGGTGGG - Intergenic
1151240780 17:72756079-72756101 AACCCTTGAGCACTGTTGGTAGG + Intronic
1153397040 18:4635108-4635130 AACCTTTGTACACTGTTGGTGGG + Intergenic
1153430548 18:5011717-5011739 AACCCTTGTACACTGTTGATGGG + Intergenic
1153821184 18:8833405-8833427 AACCCTTGAGCACTGTTGGTGGG + Intergenic
1153883392 18:9439992-9440014 AACCCTTGTGCACTGTTGGTGGG + Intergenic
1154396139 18:13991113-13991135 AACCTTTGTATACTTTTGCTGGG + Intergenic
1154507626 18:15058433-15058455 AACCCTTGTGTATTGTTGGTAGG - Intergenic
1155262278 18:24055345-24055367 AACCTTTGCATACCGTTGGTGGG - Intronic
1155701856 18:28754863-28754885 AACCCTTGTGTACTGTTGGTGGG + Intergenic
1155765930 18:29632581-29632603 AAACTTTGTACACTGTTGATGGG - Intergenic
1155860865 18:30897709-30897731 AACTGTTTGGTACTGGTGATAGG - Intergenic
1156007610 18:32462241-32462263 AACCTTTACATACTGTTGGTGGG - Intronic
1156146904 18:34193616-34193638 AACCTTTGCACACTGTTGATAGG + Intronic
1156247520 18:35316200-35316222 AACCCTTGGGCATTGCTGATGGG + Intergenic
1157351358 18:46889608-46889630 AACCCTTGTGCACTGTTGAAGGG + Intronic
1157881695 18:51327125-51327147 AACCGTTGTGTACTGTTGGTGGG - Intergenic
1158173649 18:54628269-54628291 AACCCTTGTACACTGTTGATGGG + Intergenic
1158261979 18:55616574-55616596 AACCCTTGTGCACTGTTGGTGGG - Intronic
1158753526 18:60294743-60294765 AACCCTTGTGTACTGTTGGTGGG - Intergenic
1158962730 18:62600003-62600025 AACCCTTGTGCACTGTTGGTGGG - Intergenic
1159224511 18:65514882-65514904 AACCCTTGTACACTGTTGATGGG + Intergenic
1159321664 18:66858890-66858912 AAACTCTGGATACTGTTGGTGGG + Intergenic
1159579556 18:70219673-70219695 AACTTTTGTGCACTGTTGGTAGG + Intergenic
1159710840 18:71757648-71757670 AACCCTTGTATACTGTTGATGGG + Intronic
1160127336 18:76188380-76188402 AACTCTTGTGCACTGTTGATGGG - Intergenic
1161867197 19:6841807-6841829 AACCCTTGTGCACTGTTGGTGGG - Intronic
1161955502 19:7492284-7492306 AACCTTTGTGTAATGCTGGTGGG - Intronic
1162109441 19:8392071-8392093 AAACTTTGGGTCCTGCTGATCGG + Intronic
1162664404 19:12197372-12197394 AACCTTTGTATACTGTTGATGGG - Intergenic
1162669554 19:12243779-12243801 AAGCTTTGTATACTGTTGGTGGG - Intronic
1162698246 19:12494136-12494158 AACCTTTGTACACTGTTGGTGGG + Intronic
1163015753 19:14453189-14453211 AACCTTTGTGCACTGTTGGTGGG + Intronic
1164467266 19:28498003-28498025 AACCCTTGTACACTGTTGATAGG + Intergenic
1164723865 19:30452335-30452357 AAGCTTTGTGTCCTGTTCATAGG + Intronic
1168464687 19:56592645-56592667 AACCCTTGTTTACTGTTGGTGGG + Intergenic
1168499707 19:56883350-56883372 AACCCTTGGGCACCATTGATGGG - Intergenic
1168598770 19:57701208-57701230 AACCTTGGTGTTCTGTTCATGGG - Intronic
925105907 2:1290950-1290972 AACCCTTGTGTACTATTGCTAGG - Intronic
925815291 2:7741608-7741630 AACCCTTATGCACTGTTGATAGG - Intergenic
927309338 2:21611580-21611602 AACCCTTGTACACTGTTGATAGG - Intergenic
927547092 2:23963675-23963697 AACCCTTGAACACTGTTGATGGG + Intronic
927610175 2:24531119-24531141 AACCTTTGTACACTGTTGGTAGG + Intronic
927803670 2:26125213-26125235 CACCTTTGTGTACTGTTGGTAGG - Intronic
927839017 2:26425533-26425555 AACCCTTGTGTACTGTTGGTGGG - Intronic
928112389 2:28521389-28521411 AACCCTTGTGCACTGTTGGTGGG - Intronic
928710800 2:34003192-34003214 ATCCTTTGGCCACAGTTGATTGG + Intergenic
928772828 2:34722257-34722279 GACCTTTGGGGACTGTGGAGAGG - Intergenic
928851524 2:35753285-35753307 AACCCTTGTATACTGTTGGTAGG - Intergenic
929229933 2:39548999-39549021 AACCCTTGTGTACTATTGATGGG - Intergenic
929621150 2:43355344-43355366 AACCTTTGTACACTGTTGGTGGG - Intronic
929902499 2:46017661-46017683 AACCCTGGTGCACTGTTGATGGG - Intronic
930060025 2:47280590-47280612 AACCTTTGTGTACTGTTGGTGGG - Intergenic
930497192 2:52160687-52160709 AACCCTTGTATACTGTTGGTGGG - Intergenic
930635973 2:53805758-53805780 AACCCTTGTATACTGTTGGTGGG - Intronic
930700396 2:54454831-54454853 AACCTATGTTTACTTTTGATAGG - Intergenic
931343331 2:61424013-61424035 AACCATTGTGTACTCTTGCTGGG + Intronic
931453910 2:62391920-62391942 AACCCTTGTATACTGTTGGTGGG - Intergenic
931527735 2:63176038-63176060 AATCTTTGTGCACTGTTGGTAGG - Intronic
931596183 2:63946783-63946805 AACATTTGTCTACTGCTGATGGG + Intronic
932064730 2:68542688-68542710 AACCTTTGTGCATTGTTGATGGG + Intronic
932179735 2:69635324-69635346 AACCTTTGTGCACTGTTGATGGG + Intronic
932364868 2:71144048-71144070 AACCCTTGTGCATTGTTGATAGG - Intronic
932858508 2:75264299-75264321 AACCCTTGTATACTGTTGGTGGG - Intergenic
932882966 2:75521214-75521236 AACCCTTGTGCACTGTTGATGGG + Intronic
934850249 2:97694842-97694864 AACCCTTGTGTGCTGTTGGTAGG - Intergenic
935629922 2:105205367-105205389 AACCCTTGTGCACTGTTGGTGGG - Intergenic
935829929 2:106991268-106991290 AACTCTTGTGTACTGTTGGTGGG + Intergenic
936498854 2:113049986-113050008 AACCCTTGTGCACTGTTGGTGGG + Intronic
937697645 2:124825871-124825893 AAGCTATGGGTGCTGTTCATAGG - Intronic
937793420 2:125987349-125987371 AACCCTTGTAAACTGTTGATGGG - Intergenic
937817350 2:126266291-126266313 AACCTTTGTGCACTGTTGGTTGG - Intergenic
938106249 2:128532136-128532158 AACCCTTGTTCACTGTTGATGGG + Intergenic
938508008 2:131907228-131907250 AACCCTTGTGTAGTATTGATAGG + Intergenic
938510973 2:131943567-131943589 AACTTTTCTGTACTGTTGGTGGG + Intergenic
938561868 2:132479732-132479754 AACCCTTGGGCACTGTTGGCAGG + Intronic
938561889 2:132479939-132479961 AACCCTTGGGCACTGTTGGCAGG + Intronic
938963961 2:136370327-136370349 ACCCCTTGTGCACTGTTGATGGG + Intergenic
939418806 2:141938469-141938491 AACCTTTGTACACTGTTGGTGGG + Intronic
939746065 2:145969556-145969578 AACACTTAGATACTGTTGATGGG + Intergenic
939987215 2:148841736-148841758 AACCTTTGTGCATTGTTGGTGGG - Intergenic
940132459 2:150397934-150397956 AACCCCTGTGCACTGTTGATAGG - Intergenic
940382430 2:153031182-153031204 AACCCTTGGTCACTGTTAATTGG + Intergenic
940520675 2:154742486-154742508 AACCCTTCTGCACTGTTGATGGG - Intronic
940630856 2:156236627-156236649 AACCTTTGTGTATTGCTGATGGG + Intergenic
940801049 2:158132903-158132925 AACCCTTGAATACTGTTGATGGG + Intronic
941036380 2:160573346-160573368 AACATTTGGGTACAGATGTTTGG - Intergenic
941699534 2:168589153-168589175 AACCCTTGTTTACTGTTGCTGGG - Intronic
941949231 2:171135932-171135954 AACCTTTGTGTACTGTCAGTAGG + Intronic
941966594 2:171306603-171306625 AACTCTTGTGCACTGTTGATGGG - Intergenic
942118346 2:172750596-172750618 AACCTCTGTGCACTGTTGGTGGG - Intronic
942669523 2:178359429-178359451 AACCTTTGTACACTGTTGTTGGG + Intronic
942929255 2:181470113-181470135 AACCCTTGCCCACTGTTGATGGG + Intronic
942980922 2:182080420-182080442 AACCTTTTGGTCCTGTAGAGTGG + Intronic
943021256 2:182576676-182576698 AACCCCTGTGTACTGTTGGTCGG - Intergenic
943076320 2:183199886-183199908 AACCTTTGTACACTGTTGGTGGG + Intergenic
943086725 2:183321230-183321252 AACCTTTTGGTTTTGTTGCTTGG + Intergenic
943788435 2:191904602-191904624 AAGTTTGGGGTACTGTTGAAAGG + Intergenic
944045329 2:195404412-195404434 AAACTTTGTACACTGTTGATGGG + Intergenic
944248644 2:197558927-197558949 AACCCTTGGGTGCTGTTGGTGGG - Intergenic
944258548 2:197650902-197650924 AACACTTGTGTACTGTTGGTGGG - Intronic
944372784 2:199005708-199005730 ATCCTTTGAGTGCTGTTGGTAGG - Intergenic
944546297 2:200802301-200802323 AACACTTGTGTACTGCTGATGGG + Intergenic
944935915 2:204567822-204567844 AACCTTTGCTCACTGATGATGGG - Intronic
945100059 2:206255452-206255474 GACCCTTGGGCACTGTTGGTAGG - Intergenic
945167732 2:206963950-206963972 AACCCTTATGTACTGTTGGTGGG - Intronic
945231482 2:207594830-207594852 AACTCTTGTGTACTGTTGGTAGG - Intronic
945756030 2:213847935-213847957 AAGCTTTGGGTAATTTTGAGAGG + Intronic
945852027 2:215020262-215020284 AACCCTTGTGCACTGTTGGTGGG + Intronic
946019050 2:216627166-216627188 AACCTCCAGGTACTGCTGATAGG - Intergenic
946195577 2:218031587-218031609 AACCTATGGGTGCTCTTGCTAGG - Intergenic
946924231 2:224610687-224610709 AACCCTTGTGCACTGTTGGTGGG + Intergenic
946985170 2:225264202-225264224 AACCCTTGTGCACTGTTGGTGGG + Intergenic
947015317 2:225612930-225612952 AAACTTAGGGTCCTGTTGACTGG - Intronic
947368463 2:229420799-229420821 AACCTTTGTGCACTGTTGGTAGG + Intronic
947476337 2:230451249-230451271 AACCTTTGTACACTGTTGGTGGG - Intronic
948331771 2:237173347-237173369 AACCCTTGTGCATTGTTGATGGG - Intergenic
948379229 2:237541371-237541393 GACCTTTGTGCACTATTGATGGG - Intronic
948706568 2:239796927-239796949 AACCCTTGTGTACTGTCGGTGGG - Intronic
1169422019 20:5468247-5468269 AACCTTTGTGCACTGTTTGTGGG + Intergenic
1169513284 20:6289078-6289100 AACCCTTGTACACTGTTGATGGG + Intergenic
1169975257 20:11318458-11318480 AACTCTTGTATACTGTTGATAGG + Intergenic
1170236521 20:14111740-14111762 AACCTTTGTACACTGTTGATGGG + Intronic
1170263432 20:14438522-14438544 AACCTTTGTAAACTGTTGGTGGG - Intronic
1170777927 20:19394748-19394770 AACCTTTGTGTACTCTTGGAGGG + Intronic
1171278894 20:23880253-23880275 AACCTTTGGGTAAAGTTCACTGG + Intergenic
1171402702 20:24888466-24888488 AACCCTTGTACACTGTTGATAGG + Intergenic
1172974750 20:38897704-38897726 AATCCTTGTGTACTGTTGGTGGG - Intronic
1173079849 20:39855306-39855328 AATCCTTGTGCACTGTTGATGGG - Intergenic
1173574500 20:44103238-44103260 AACCCTTGTGTACTCTTGGTGGG + Intergenic
1174061668 20:47837402-47837424 AGCTTTTTGGTTCTGTTGATGGG - Intergenic
1175173939 20:57098663-57098685 AACCCTCGGATACTGTTGGTGGG + Intergenic
1175234098 20:57497074-57497096 AACCGTTGTGCACTGTTGGTGGG - Intronic
1175514828 20:59562505-59562527 AACCCTTGTGCACTGTTGGTGGG + Intergenic
1175554926 20:59844194-59844216 AACTTTTATATACTGTTGATGGG + Intronic
1176781938 21:13206774-13206796 AACATTTCTGTACTGTTGGTGGG + Intergenic
1176790453 21:13313348-13313370 AACCCTTGTGTATTGTTGGTAGG + Intergenic
1176890203 21:14307322-14307344 AACCCTTGTGTACTGTTGGTGGG + Intergenic
1177297255 21:19192119-19192141 AACAGTTGGGTACATTTGATTGG + Intergenic
1177595683 21:23239362-23239384 ACCTTTTGGGTACTGTTGATTGG - Intergenic
1177980493 21:27908527-27908549 AACTTTTCTGTACTGTTGATGGG - Intergenic
1177983517 21:27945058-27945080 AACCCTTGTGTAGTATTGATAGG - Intergenic
1177989627 21:28021590-28021612 AACCCTTGTGTATTGTTGGTAGG + Intergenic
1178260021 21:31090146-31090168 AACCCTTGTGTGCTGTTGGTAGG - Intergenic
1179130525 21:38632402-38632424 AACCCTTATGCACTGTTGATGGG + Intronic
1179158293 21:38870557-38870579 AACCCTTGTACACTGTTGATGGG - Intergenic
1180486936 22:15810116-15810138 AACCCTTGCATACTGTTGGTGGG + Intergenic
1180937473 22:19635445-19635467 AACCCTTGTGCACTGTTCATGGG + Intergenic
1181091982 22:20479759-20479781 AACCCTTGTGCACTGTTGGTGGG + Intronic
1181449135 22:23005985-23006007 AACCTCTGGGGACTGTTGTGGGG + Intergenic
1181583420 22:23840093-23840115 AACCCTTGGGCACCGTTGGTGGG + Intergenic
1181898316 22:26130694-26130716 AACCCCTGTGTACTGTTGGTGGG - Intergenic
1181970655 22:26687326-26687348 CACCTGTGGACACTGTTGATTGG + Intergenic
1181994541 22:26865493-26865515 AACCCTTGTGCACTGTTGGTGGG - Intergenic
1182002321 22:26930056-26930078 AACCCTTGTGCACTGTTGGTGGG - Intergenic
1182156693 22:28080297-28080319 AACCTTTGTGCATTGTTGGTGGG - Intronic
1182173456 22:28257131-28257153 AACCTTTGTACACTGTTGGTGGG + Intronic
1183603734 22:38855899-38855921 AACCCTTGTGCACTGTTGGTAGG - Intergenic
1183873852 22:40762305-40762327 AACCCTTGTGCACTGTTGGTGGG + Intergenic
1183877052 22:40791770-40791792 AACTTCTGTGTACTGTTGGTGGG + Intronic
949429138 3:3954067-3954089 AACCCTTGTATACTGTTGGTGGG - Intronic
949907560 3:8871420-8871442 AACCCTTGTGCACTGTTGATGGG + Intronic
950061055 3:10071221-10071243 AACCTTTGTACACTGTTGGTGGG + Intronic
950302069 3:11889110-11889132 AACCTTTGTACACTGTTGGTGGG + Intergenic
950753217 3:15148082-15148104 AACCTTTGTCCACTGTTGGTGGG + Intergenic
950999368 3:17539953-17539975 AACCCTTGTGCACTGTTGGTGGG - Intronic
951095669 3:18626975-18626997 AACTCTTGTGTACTGTTGGTTGG + Intergenic
951691601 3:25402333-25402355 AACCCTTGTACACTGTTGATGGG + Intronic
951760530 3:26142772-26142794 AACCCTTGTGCACTGTTGACAGG + Intergenic
952135932 3:30419616-30419638 AACCTTTGAATACTGTTGGTGGG + Intergenic
952844732 3:37678283-37678305 AACCCTTGTGCACTGTTGGTAGG - Intronic
952906826 3:38144918-38144940 AACCTTTGATCACTTTTGATGGG + Intergenic
953166761 3:40472006-40472028 AACCCTTGTACACTGTTGATGGG - Intergenic
953712088 3:45282228-45282250 AACCCTTGTGTGCTGTTGATTGG + Intergenic
953812740 3:46128542-46128564 AACCCTTGCGCACTGTTGGTGGG + Intergenic
954049839 3:47965508-47965530 AACCCTTGTGTACTGCTGATAGG - Intronic
954741695 3:52757131-52757153 AACCTTTGTGTACTGCTGATAGG + Intronic
954856094 3:53644934-53644956 AAGCTTTGTACACTGTTGATAGG - Intronic
955313709 3:57916684-57916706 AACCTTTGTGTATATTTGATGGG + Intronic
957574752 3:81992723-81992745 AACTTTTGTGTACTGTTGGTGGG + Intergenic
957732722 3:84162274-84162296 AAACTTTGTGTCCTGTTGGTAGG - Intergenic
957889757 3:86341208-86341230 AGCCCTGGTGTACTGTTGATAGG - Intergenic
958599130 3:96271481-96271503 AACTTTTATATACTGTTGATGGG - Intergenic
958745023 3:98123586-98123608 AAGCTTTGTATACTGTTGCTGGG + Intergenic
959090180 3:101893918-101893940 AACCCTTGTGTACTGCTGGTAGG - Intergenic
959119392 3:102214643-102214665 AACCTTTGAGCATTCTTGATGGG - Intronic
959625876 3:108450086-108450108 AACCCTTGTACACTGTTGATGGG + Intronic
959865508 3:111265101-111265123 AACCCCTGTGTACTGTTGGTAGG + Intronic
959987249 3:112588126-112588148 AACCCTTGTATACTGTTGGTGGG + Intergenic
960046308 3:113201708-113201730 AACCCTTGCACACTGTTGATGGG - Intergenic
960427662 3:117528785-117528807 AACCTTTGTACACTGTTGGTGGG - Intergenic
960468319 3:118026945-118026967 AACCCTTGTACACTGTTGATGGG - Intergenic
960469587 3:118046120-118046142 AACCCTTGTATACTGTTGGTGGG + Intergenic
960706450 3:120486732-120486754 AACCCTTGTATACTGTTGTTGGG - Intergenic
960904074 3:122581320-122581342 AATCCTTGTGTACTGTTGGTGGG - Intronic
961070852 3:123924784-123924806 AACCCTTGTATACTGTTGGTAGG + Intronic
961331568 3:126145239-126145261 AACCTTTGTGCACTGTTGGTGGG + Intronic
961500944 3:127335327-127335349 AACCCTTGTACACTGTTGATGGG + Intergenic
961587325 3:127943300-127943322 AACCCTTGTACACTGTTGATGGG - Intronic
961854050 3:129851617-129851639 AATCTTTGTGCATTGTTGATGGG + Intronic
961857018 3:129882395-129882417 AACCCTTGTGCACTGCTGATAGG + Intronic
962289031 3:134115046-134115068 AACCTTTGTGCACTGTTGGCGGG + Intronic
962801079 3:138891100-138891122 AACCTTTACGCATTGTTGATGGG + Intergenic
962934853 3:140070665-140070687 AACCTTTTGGGACTATTGTTTGG - Intronic
963438036 3:145296990-145297012 AACCTTTGTACACTGTTTATAGG + Intergenic
963768117 3:149359685-149359707 AACCCTTGCGCACTGTTGGTGGG + Intergenic
963955652 3:151250877-151250899 CACCTTTGTGCACTGTTGGTGGG - Intronic
964821721 3:160777977-160777999 AACCTTTGTGCACTGTTGGCAGG - Intronic
966075225 3:175927741-175927763 AACTCTTGTATACTGTTGATTGG + Intergenic
966096953 3:176214977-176214999 AACCCTTGGGCACTCTTGCTGGG + Intergenic
966148337 3:176837889-176837911 AATCTTTGCACACTGTTGATGGG + Intergenic
966517934 3:180839916-180839938 AACCGTTGTATACTGTTGGTGGG - Intronic
966717167 3:183024677-183024699 AGCCATTGTGCACTGTTGATGGG + Intronic
966963737 3:184968490-184968512 AACCCTTGTGTACTGTTGGTGGG - Intronic
967199747 3:187062213-187062235 AATCCGTGGGCACTGTTGATGGG + Intronic
967758215 3:193194600-193194622 AAGCTCTGGGTACAGCTGATTGG + Intergenic
968098387 3:195948238-195948260 GTCCTTTAGGTTCTGTTGATGGG - Intergenic
968792415 4:2676232-2676254 AACCCTTGTGCACTGTTGGTGGG - Intronic
969100859 4:4767138-4767160 AACCCTTGGGTGTTGTTGGTGGG + Intergenic
970372419 4:15421427-15421449 GACCTTTGGCTACTGTTCTTTGG - Intronic
971030648 4:22634144-22634166 AACCCTTGTGCATTGTTGATGGG - Intergenic
971557574 4:28034238-28034260 TACCCTTGTGTACTGTTGGTGGG + Intergenic
971778987 4:31006091-31006113 AAATTTTGGCTACTGTTGTTAGG + Intronic
972180107 4:36454000-36454022 AACCTTTGTGCACTGTTGATAGG - Intergenic
972332057 4:38073226-38073248 AGCCCTTGGGCACTGTTGGTGGG - Intronic
972744356 4:41919061-41919083 AACCGTTGGCTACATTTGATCGG - Intergenic
973029163 4:45313397-45313419 AACCCTTGTGTACCATTGATGGG + Intergenic
973730673 4:53819414-53819436 AACCCTTGTACACTGTTGATGGG + Intronic
974801109 4:66819243-66819265 AACCCTTGTACACTGTTGATGGG + Intergenic
975030975 4:69615788-69615810 AACCCTTGTGCACTGTTGGTGGG + Intronic
975100168 4:70503750-70503772 AATCTTTGTGCACTATTGATGGG + Intergenic
975153253 4:71043967-71043989 AACCTTTGTAAACGGTTGATGGG + Intergenic
975279057 4:72539554-72539576 AAACTCTGTGCACTGTTGATGGG + Intronic
976056492 4:81074883-81074905 AACCTTTGTATACTGTTGTTGGG + Intergenic
976138867 4:81968678-81968700 AACCTTTGTACACTGTTGGTGGG + Intronic
976417205 4:84790989-84791011 AACCCTTGCGCACTGTTGGTGGG + Intronic
976459694 4:85295389-85295411 AACCTTTGCGCACTGTTGGTGGG + Intergenic
976459768 4:85296399-85296421 AACCTTTGTATACTGTTGATGGG + Intergenic
976574086 4:86648840-86648862 AACCCTTGTATACTGTTGGTGGG - Intronic
977197314 4:94079552-94079574 AACTTTTATGTACTGTTGGTGGG - Intergenic
977356308 4:95951880-95951902 AAACTTTGGGGACTGTTGGAAGG - Intergenic
977502699 4:97861373-97861395 AGCCTTTGGCCACTGTTGGTGGG + Intronic
977650592 4:99464298-99464320 AACCCTTGTACACTGTTGATGGG - Intergenic
978064172 4:104375868-104375890 AACCTTTGTATACTGTTGGTAGG + Intergenic
978516724 4:109576759-109576781 AACCTTGGACTACTATTGATGGG + Intronic
978587119 4:110285245-110285267 AACCTTTGTCCACTGTTGATAGG + Intergenic
979041959 4:115809650-115809672 AATCTTTGTATACTGTTGGTGGG + Intergenic
979692103 4:123570682-123570704 AACCATTTTGTACTGTTGTTGGG - Intergenic
979739913 4:124136560-124136582 AACAATTGGGCACTGGTGATAGG + Intergenic
979873573 4:125857757-125857779 AACCCTTGGGTACTGTTAGTGGG - Intergenic
980040045 4:127928622-127928644 AACCCTTGTATACTGTTGGTGGG + Intronic
980189311 4:129503000-129503022 AACCCTTATGTACTGTTGGTGGG + Intergenic
980477714 4:133340070-133340092 AACTTTTGTACACTGTTGATGGG - Intergenic
980683226 4:136191006-136191028 AACCCTTGTACACTGTTGATGGG + Intergenic
980850709 4:138378001-138378023 AACCCTTGTACACTGTTGATGGG + Intergenic
981868678 4:149460028-149460050 AACCCTTGTGTACCGTTGGTGGG - Intergenic
981990201 4:150909771-150909793 TACCTTTGTGCACTGTTGAGGGG - Intronic
982063978 4:151635254-151635276 AACCTTTGTGTCTTGTTTATGGG + Intronic
982315944 4:154032017-154032039 AACCTTTGTACACTGTTGGTGGG - Intergenic
982339576 4:154282554-154282576 AACCTTTGTGCACTGTTGCTGGG + Intronic
982342699 4:154319716-154319738 AACCCTTGTATACTGTTGGTGGG + Intronic
982361749 4:154525865-154525887 AACCCTTGTGCACTGTTGATGGG + Intergenic
982525255 4:156469738-156469760 AACCTTTGTGCCCTATTGATGGG + Intergenic
982583848 4:157212384-157212406 AACTTTTGTATACTGTTGGTGGG - Intronic
982989005 4:162246685-162246707 ATCCTTTGCCTACTTTTGATGGG + Intergenic
983142420 4:164168303-164168325 AACCTTAGTGTATTGTTGGTAGG + Intronic
983159832 4:164398765-164398787 AATCCTTGTGCACTGTTGATAGG - Intergenic
983370286 4:166850194-166850216 TACCCTTGTGTACAGTTGATGGG - Intronic
983703352 4:170626014-170626036 AACCCTTGTATACTGTTGCTGGG - Intergenic
983736244 4:171065471-171065493 AAACTTTGTACACTGTTGATGGG + Intergenic
983739326 4:171108503-171108525 AACCCTTTTGTACTGTTGGTGGG + Intergenic
983868728 4:172799645-172799667 CACCCTTGTGTACTGTTGCTGGG + Intronic
984018795 4:174459271-174459293 AACCCTTGTATACTGTTAATGGG - Intergenic
984239288 4:177198380-177198402 AACCTTTGTACACTGTTGGTGGG - Intergenic
984354916 4:178645574-178645596 AACCCTTGTACACTGTTGATGGG - Intergenic
984823141 4:183901524-183901546 AACCTTTGTGCACTGTTGGTAGG - Intronic
985232149 4:187830774-187830796 AACCTTTCTATACTGTTGGTGGG - Intergenic
985374948 4:189325197-189325219 AACCCTTGTACACTGTTGATAGG - Intergenic
985485976 5:149898-149920 AACCCTTGTGCACGGTTGATGGG + Intronic
985690003 5:1302707-1302729 AACCCTTGGACACTGTTGGTGGG - Intergenic
986288699 5:6380296-6380318 AACCCTTGTACACTGTTGATGGG + Intergenic
986312374 5:6561866-6561888 AACCTTTTTGTACTGTTGATGGG + Intergenic
986624511 5:9711036-9711058 AACCCTTGTGCATTGTTGATGGG + Intronic
987773771 5:22337950-22337972 AACCTTTGTACACTGTTGGTGGG + Intronic
988037469 5:25846256-25846278 AACCATTGTGCACTGCTGATGGG + Intergenic
988138056 5:27200687-27200709 AGACTTTGGGGACTGTTGAAAGG - Intergenic
988780795 5:34519964-34519986 AACCTTTGTACACTGTTGGTGGG + Intergenic
988862027 5:35291664-35291686 GACCTTTGTACACTGTTGATGGG - Intergenic
989428324 5:41322438-41322460 AACCCTTGTATACTGTTGGTGGG + Intronic
990121496 5:52459566-52459588 AAACCTTGTATACTGTTGATGGG - Intergenic
990215145 5:53522355-53522377 AACCCTTGTGTACTGTTGTTAGG - Intergenic
990801035 5:59603526-59603548 AACCCTTGTACACTGTTGATGGG + Intronic
990812434 5:59743563-59743585 AACCCTCGTGCACTGTTGATAGG + Intronic
990898520 5:60725728-60725750 AACCATTGTGCACTGTTGGTGGG - Intergenic
990923251 5:60991907-60991929 AACCCTTGTATACTGTTGGTGGG - Intronic
990927909 5:61050183-61050205 AACCCTTGTGCACTGTTGGTGGG - Intronic
992065812 5:73106887-73106909 AACCCTTGTGCACTGTTGGTGGG - Intergenic
992306246 5:75442010-75442032 AACCCTTGTGCCCTGTTGATAGG - Intronic
992453599 5:76895383-76895405 ATCATTTGGGAATTGTTGATAGG - Intronic
993026453 5:82652676-82652698 AACCCTTGGACACTGTTGGTGGG - Intergenic
993065431 5:83091972-83091994 AACCTTTGTATCCTGTTGGTAGG - Intronic
993163837 5:84325517-84325539 AACCCTTGTGTACTGTTGGTGGG + Intronic
993304484 5:86257994-86258016 AACCCATGTGCACTGTTGATGGG + Intergenic
993537805 5:89108316-89108338 AACCCTTGTACACTGTTGATGGG + Intergenic
993561340 5:89414520-89414542 AACCTTTGGCTACTAATGATTGG + Intergenic
994671657 5:102768959-102768981 AACCTTTGAACACTGTTGGTGGG - Intronic
994690388 5:103011871-103011893 AACCCTTGTATACTGTTGGTGGG - Intronic
994924084 5:106091165-106091187 AACCTTTGTACACTGTTGGTGGG - Intergenic
995282545 5:110352403-110352425 ACCCTCTGGGTACTGTTGTGGGG - Intronic
995382967 5:111555462-111555484 AAGCTTTGTGCCCTGTTGATGGG - Intergenic
995771016 5:115670196-115670218 AACCCTTGTACACTGTTGATGGG + Intergenic
995932550 5:117465493-117465515 AACATTTGGACACTGTTGGTGGG - Intergenic
995935738 5:117510942-117510964 AACCCTTGCATACTGTTGAGGGG + Intergenic
996204330 5:120712853-120712875 AACCTTTGCACACTGTTGATAGG + Intergenic
996292524 5:121868956-121868978 AACCTTTGTCCACTGTTGGTGGG + Intergenic
996475822 5:123919418-123919440 AACCTTTGTACACTGTTGGTGGG - Intergenic
996957897 5:129207314-129207336 AACCTTTGTACACTGTTGGTGGG - Intergenic
997317157 5:132946198-132946220 AACCTTTGTGCACTGCTGGTGGG + Intronic
998274982 5:140743923-140743945 AACCTTTGTGCACTATTAATGGG - Intergenic
998656355 5:144184621-144184643 AACCTTTGTGCACTGTTGGTGGG - Intronic
998898815 5:146830418-146830440 AAGGTTCGGGTACTGTTGGTTGG - Intronic
1000108650 5:158085610-158085632 AACCCTGGTGCACTGTTGATGGG - Intergenic
1000842638 5:166240435-166240457 AACCCTTGTGCACTGTTGGTGGG + Intergenic
1001760301 5:174202668-174202690 AACCCTTGTTCACTGTTGATGGG - Intronic
1002209689 5:177590410-177590432 AACCCTTGTGCACTGTTGGTGGG - Intergenic
1002503164 5:179660296-179660318 AACCCTTGTGCACTGTTGGTGGG + Intergenic
1002890756 6:1329724-1329746 AACCCTTGTACACTGTTGATGGG - Intergenic
1003013327 6:2447173-2447195 AACCTTTGCATACCGTTGGTGGG - Intergenic
1003227371 6:4218486-4218508 GACTTTTGGGTACTGTTGGAAGG - Intergenic
1003507978 6:6755418-6755440 AACCCTTGTGCACTGTCGATGGG - Intergenic
1003804273 6:9708302-9708324 AACCTTTGTGTACTATTGGCAGG + Intronic
1004091858 6:12511564-12511586 AACTTTTGGACACTGTTGATGGG + Intergenic
1004692036 6:18000648-18000670 AACCCTTGTATACTGTTGGTGGG + Intergenic
1004698828 6:18059501-18059523 AACACTTGTGCACTGTTGATGGG - Intergenic
1004901548 6:20199007-20199029 AACATTTGGCTACATTTGATTGG - Intronic
1007147983 6:39656600-39656622 ATCTTTTGGGTACTGTAGACAGG - Intronic
1008108963 6:47471879-47471901 AACCTTTGTACACTGTTGGTGGG + Intergenic
1008457852 6:51732666-51732688 AACCATTGTGTACTGTTGGTGGG + Intronic
1008956740 6:57223854-57223876 AACCTTTGTGTGCTGCTGGTGGG + Intergenic
1009740368 6:67735163-67735185 AACCCTTGTGTACTTTAGATGGG - Intergenic
1009925562 6:70116364-70116386 AAACATTGGGTGCTGGTGATGGG + Intronic
1010215441 6:73397165-73397187 AACCCCTGTGTACTGTTGGTGGG - Intronic
1010394870 6:75379578-75379600 AACACTTGGGTCCTGTTGCTGGG - Intronic
1010480099 6:76340868-76340890 AACCTTTGTATGCTGTTGGTGGG + Intergenic
1010588531 6:77684961-77684983 AACCTTTGTACACTGTTGGTGGG - Intergenic
1010824765 6:80459010-80459032 AACCGTTGTGCAATGTTGATGGG + Intergenic
1011013961 6:82734587-82734609 AACCCTTGTATACTGTTGGTGGG - Intergenic
1011186390 6:84681364-84681386 AAAGTATGGGGACTGTTGATTGG - Intergenic
1012256906 6:97043673-97043695 AACCTTTGTGCACTGTTAGTGGG - Intronic
1012300605 6:97582847-97582869 AACCTTTATATACTGTTGGTGGG - Intergenic
1012670719 6:102043824-102043846 AACCCTTGCATACTGTTGGTGGG - Intronic
1013023224 6:106241374-106241396 AACCTTTGTGCACTGTTGGTGGG + Intronic
1013340963 6:109215289-109215311 AACCTTTGTGCACTGTTGGTGGG - Intergenic
1013799711 6:113928759-113928781 AACCCTTGTGCACTGTTGGTAGG - Intergenic
1014385461 6:120795749-120795771 AATCTTTGTGTACTGTTGGTGGG - Intergenic
1014583492 6:123167692-123167714 AACCCTTGTATACTGTTGGTGGG + Intergenic
1014782700 6:125583089-125583111 AACCCTTGTACACTGTTGATGGG - Intergenic
1015325726 6:131921211-131921233 AACCCTTGTATACTGTTGATGGG + Intergenic
1015470487 6:133599936-133599958 ATCCTTTGGCTACAGTTAATTGG - Intergenic
1015695324 6:135973583-135973605 AACCCTTGTGTACTATTGATGGG - Intronic
1016193116 6:141295400-141295422 AACCTTTGTGGACTATTGGTGGG - Intergenic
1016366073 6:143320246-143320268 AACCCTTGTACACTGTTGATGGG + Intronic
1016497661 6:144682593-144682615 AACCCTTGTGAACTGTTGGTGGG - Intronic
1017307064 6:152931043-152931065 AACCCTTGTGCACTGTTGGTGGG + Intergenic
1017432914 6:154388623-154388645 AACCCTTGCATACTGTTGATGGG - Exonic
1017500874 6:155021631-155021653 AACCCTTGTGCACGGTTGATTGG - Intronic
1018069019 6:160144906-160144928 AACCTTTGTGAACTGTTGGTGGG - Intronic
1019755631 7:2766847-2766869 AACCCTTGTGCACTGTTGGTGGG - Intronic
1019881344 7:3864041-3864063 AACCTGTGTGCACTGTGGATGGG - Intronic
1020458738 7:8404074-8404096 AACCCTTGTGTACTGTTGATGGG + Intergenic
1020675524 7:11179478-11179500 AACCCTTATGCACTGTTGATGGG - Intergenic
1020744327 7:12062801-12062823 AACCCTTGGGTAATGTTGCTGGG + Intergenic
1020765596 7:12316184-12316206 AACCTTTGTATACTGTTGGTAGG + Intergenic
1020873269 7:13661488-13661510 AACCCTTGAGAACTGTTGGTGGG + Intergenic
1021343744 7:19496620-19496642 ACCCTCTGAGTTCTGTTGATGGG + Intergenic
1021391407 7:20097442-20097464 AACCCTTGTGTACTGTTTGTGGG + Intergenic
1021636019 7:22694347-22694369 AACCCTTGTATACTGTTGCTGGG + Intergenic
1021966139 7:25921002-25921024 AACCCTTGTGCACTGTTGGTGGG + Intergenic
1022216515 7:28267962-28267984 ACCCTTTGTATACTGTTGGTGGG - Intergenic
1022388024 7:29919783-29919805 AACCCTTATGTACTGTTGGTGGG - Intergenic
1023104367 7:36748964-36748986 AACCCTTGGACACTGTTGGTGGG + Intergenic
1023111796 7:36820541-36820563 AACCTTTGTGTATTGCTGGTAGG + Intergenic
1024029008 7:45440695-45440717 AACCTTTGTACACTGTTGGTGGG + Intergenic
1024245513 7:47466881-47466903 AACCTTTGGGAACTGTTCTTTGG - Intronic
1024317141 7:48031578-48031600 AACCCTTGTATACTGTTGGTGGG + Intergenic
1024454640 7:49589919-49589941 AACCCTTGTGCACTGCTGATGGG + Intergenic
1024498769 7:50077772-50077794 AACCCTTGTACACTGTTGATGGG + Intronic
1024683696 7:51720895-51720917 AACCCTTGAGCACTGTTGGTGGG - Intergenic
1024961819 7:54984597-54984619 AACCCTTGTGTGCTGTTGGTGGG - Intergenic
1028521505 7:91736255-91736277 AACCCTTGTGCACTGTTGTTTGG - Intronic
1028960713 7:96747046-96747068 AACATTTGGGTACTTTTAGTGGG - Intergenic
1029009799 7:97247296-97247318 AACCCTTGCACACTGTTGATGGG + Intergenic
1031074129 7:117196382-117196404 AACCCTTGTGCACTGTTGGTGGG - Intronic
1031289189 7:119910508-119910530 AATGCTTGTGTACTGTTGATGGG - Intergenic
1031433598 7:121705003-121705025 AACCCTTGTACACTGTTGATGGG + Intergenic
1031653482 7:124321583-124321605 AACCCTTGTGCACTGTTGGTGGG + Intergenic
1032185771 7:129724411-129724433 AACCCTTGTGCACTGTTGGTGGG + Intronic
1033369081 7:140692938-140692960 ACCCCTTGTGTACTGTTGGTGGG - Intronic
1033647150 7:143314410-143314432 AACCCTTGTGCACTGTTGGTGGG - Intergenic
1034033400 7:147792811-147792833 AACCTTTATACACTGTTGATGGG - Intronic
1034145891 7:148871223-148871245 AACCTTTGTGCACTGTGGGTAGG + Intronic
1034687706 7:152987781-152987803 AGCCTTCGTGCACTGTTGATGGG + Intergenic
1034833028 7:154326252-154326274 AAGCCTTGGGTTCTGTTTATGGG + Intronic
1035018370 7:155785983-155786005 AACCCTTGAGCACTGTTGGTGGG - Intergenic
1035864134 8:3063379-3063401 AACCCTTGTGTACTGTCAATAGG + Intronic
1036271383 8:7306582-7306604 AACCTTTGTATACTGGTGGTGGG + Intergenic
1036349965 8:8003761-8003783 AACCTTTGTATACTGGTGGTGGG - Intergenic
1036510954 8:9399691-9399713 AACCTTTGTGCACTGTTGGTGGG + Intergenic
1036845235 8:12164275-12164297 AACCTTTGTATACTGGTGGTGGG - Intergenic
1036866604 8:12406596-12406618 AACCTTTGTATACTGGTGGTGGG - Intergenic
1036937714 8:13019929-13019951 AAGGTTTGTGTGCTGTTGATAGG + Intronic
1037178893 8:15979884-15979906 AACCTTTGTAGACTGTTGGTGGG - Intergenic
1037954830 8:23047735-23047757 AACCCTTGCTTACTGTTGGTGGG + Intronic
1037997258 8:23361914-23361936 AACCCTTGTGCACTGTTGATGGG + Intronic
1038135940 8:24785842-24785864 AACCCTTGTGCACTATTGATGGG + Intergenic
1038238861 8:25788856-25788878 AACCCTTGTGCACTGTTGGTGGG - Intergenic
1038320696 8:26524129-26524151 AAACCTTGGGAACTGTTGTTGGG - Intronic
1038767263 8:30440731-30440753 AACCTTTATGCACTGTTGTTGGG - Intronic
1040494263 8:47951995-47952017 AACCCTTGTGCACTGTTGGTGGG + Intronic
1040655997 8:49508462-49508484 AACATGTGTGCACTGTTGATGGG - Intergenic
1040912713 8:52537350-52537372 AACCTTTATATACTGTTGGTGGG + Intronic
1041206374 8:55502329-55502351 AACACTTGTGTACTGTTGGTGGG - Intronic
1041348995 8:56929887-56929909 CACAGGTGGGTACTGTTGATGGG + Intergenic
1041364562 8:57087865-57087887 AACCCTTGTACACTGTTGATAGG + Intergenic
1041849961 8:62379351-62379373 GACTTTTGGGGACTGTTGAAAGG + Intronic
1041893598 8:62899111-62899133 AACCCTTGTATACTGTTGATGGG + Intronic
1041982219 8:63875411-63875433 AACTCTTGTATACTGTTGATGGG - Intergenic
1042073593 8:64963528-64963550 AACCCTTGAGTACTGTTGGTGGG + Intergenic
1042074248 8:64972228-64972250 AACCCTTGTATGCTGTTGATGGG - Intergenic
1042177400 8:66050473-66050495 AACATTTGGGTATTGTTGGCTGG - Intronic
1042726334 8:71881672-71881694 AACCTTTGTACACTTTTGATGGG - Intronic
1042981198 8:74530931-74530953 AACCCTTGTATACTGTTGATGGG + Intergenic
1043235785 8:77864240-77864262 AACCCTTGTATACTGTTGATGGG + Intergenic
1043317062 8:78936027-78936049 AATCCTTGTATACTGTTGATGGG - Intergenic
1043770925 8:84199105-84199127 AACCCTTGTATACTGTTGGTGGG - Intronic
1044006881 8:86948368-86948390 AACCCTTGTATACTGTTGGTGGG - Intronic
1044090204 8:87990805-87990827 AATATTGGGGTACTGTTAATTGG + Intergenic
1044269049 8:90218758-90218780 AACTTTTGTGCACTGTTGATGGG - Intergenic
1044584058 8:93852585-93852607 AACCTTTGCACACTGTTGGTGGG + Intergenic
1044737644 8:95295627-95295649 AACATTTGGGTCCTTTTGACTGG + Intergenic
1045364760 8:101465535-101465557 AACTCTTGTGTACTGTTGGTGGG + Intergenic
1046508649 8:115170630-115170652 AACCTTTGTGCACTGTCGGTGGG + Intergenic
1046895993 8:119474024-119474046 AAACTCTGGGGACTGTTGAGGGG - Intergenic
1047001102 8:120573135-120573157 AATCCTTGTATACTGTTGATAGG - Intronic
1047158245 8:122346581-122346603 AACCCTTGTGCACTGTTGATGGG + Intergenic
1047382873 8:124380207-124380229 AACCCTTGTACACTGTTGATGGG - Intergenic
1048933066 8:139331563-139331585 AACCTTTGGACACTGTTGGTGGG - Intergenic
1049067769 8:140331855-140331877 AACTCTTAGGTGCTGTTGATAGG + Intronic
1049138453 8:140928336-140928358 AACCCTTGTGTATTGTTGGTGGG + Intronic
1049165786 8:141125045-141125067 AACCCTTGTGGACTGTTGTTGGG - Intronic
1049366841 8:142243131-142243153 AACCCTTGCGCACTGTTGGTGGG + Intronic
1049532778 8:143163772-143163794 AACCGTTGTGCACTGTTGGTGGG + Intergenic
1050041102 9:1494712-1494734 AACCCTTGTACACTGTTGATGGG - Intergenic
1050047859 9:1566897-1566919 AACCTTTGTACACTGTTGGTGGG - Intergenic
1050186191 9:2976946-2976968 AACCCTTGAGCACTGTTGGTGGG + Intergenic
1050522408 9:6514971-6514993 AACCTTTGTATATTGTTGGTGGG - Intergenic
1051313265 9:15800226-15800248 AACCTTTGTATGCTGTTGGTGGG - Intronic
1051656043 9:19382815-19382837 AACCCTTGTGTACTGTTGGTGGG - Intergenic
1051832147 9:21291605-21291627 AACCCTTGTGCCCTGTTGATGGG + Intergenic
1052262473 9:26533446-26533468 AACCCTTGCACACTGTTGATGGG + Intergenic
1052452079 9:28644064-28644086 AACCCTTGTGCACTGTTGGTAGG + Intronic
1052611312 9:30777856-30777878 AACCTTTGTACACTGTTGGTGGG + Intergenic
1052926154 9:34018385-34018407 AACCCTTGTGCACTGCTGATGGG + Intronic
1053436415 9:38078035-38078057 AACCTCTGCACACTGTTGATGGG - Intergenic
1053516280 9:38733466-38733488 AAGCTTTGGGTAATGTCTATAGG + Intergenic
1055229116 9:74040311-74040333 AACTTTTGACTACTGTTGACTGG - Intergenic
1055395743 9:75873198-75873220 AACCTTTGTACACTGTTGGTGGG + Intergenic
1055674911 9:78648275-78648297 AACGTTTGTACACTGTTGATGGG + Intergenic
1055821791 9:80273961-80273983 AACCTTTCTGTATTGTTGGTAGG + Intergenic
1055901761 9:81247412-81247434 AACCCTTGGGCACTGTTGGTAGG + Intergenic
1055922782 9:81479129-81479151 ACCCTTTGGCTATTGTGGATGGG - Intergenic
1056024046 9:82473947-82473969 AACTCTTGGGCACTGTTGGTGGG + Intergenic
1056228785 9:84523897-84523919 AACCTTTGTACACTGTTAATGGG - Intergenic
1056349459 9:85734636-85734658 AATCTTTGTGCACTATTGATAGG + Intronic
1056498172 9:87180850-87180872 AACTCTTGTGTACTGTTGGTGGG + Intergenic
1057864725 9:98670371-98670393 AACCCTTGGGCACTGTTGGTGGG + Intronic
1057967787 9:99520958-99520980 AATCCTTGTGCACTGTTGATGGG + Intergenic
1058197053 9:101990405-101990427 AATCTTTGTATGCTGTTGATGGG + Intergenic
1058476477 9:105339285-105339307 AACCTTTGTGTACCGTTGATGGG + Intronic
1058631863 9:106997205-106997227 AACCCTTGTGCACTGTTGATAGG + Intronic
1059226447 9:112677486-112677508 AACCTCTGTGCACTGTTGGTAGG - Intergenic
1059816039 9:117916629-117916651 AACCCTTGTGAACTGTTGGTAGG + Intergenic
1060253902 9:122008591-122008613 AACCTTTGCACACTGTTGGTGGG + Intronic
1060383191 9:123196766-123196788 AACCCTTGTATACTGTTGGTAGG + Intronic
1060425505 9:123501574-123501596 AACCTTTGGGTACTGTTGATGGG - Intronic
1062153903 9:135035491-135035513 AACCTTTGGGCACTGCTGATGGG - Intergenic
1062202300 9:135309958-135309980 GACCCTTGGGGGCTGTTGATGGG + Intergenic
1062296724 9:135834184-135834206 AACCTTTGCATACTGTTGGTGGG + Intronic
1186264753 X:7820112-7820134 AACCCTTGTGCACTGTTGGTGGG - Intergenic
1186425518 X:9462305-9462327 AAATTTTGGGTACTGTTTATGGG + Intergenic
1187630945 X:21171308-21171330 AACCTTTGCACACTGTTGGTAGG + Intergenic
1187941710 X:24388942-24388964 AACCCTTGTGCACTGTTGATGGG - Intergenic
1188058549 X:25571282-25571304 AACCCTTGTGCACTGTTGCTGGG - Intergenic
1188076681 X:25785406-25785428 AACCCTTGTGCACTGTTGGTAGG + Intergenic
1188229943 X:27649419-27649441 AACATTTACATACTGTTGATGGG - Intronic
1188738636 X:33749743-33749765 AACTCTTGTGCACTGTTGATGGG - Intergenic
1188860465 X:35249929-35249951 AACCATTGTGCACTGTTGGTGGG - Intergenic
1188977584 X:36693574-36693596 AATCTTTGTATACTGTTGGTAGG + Intergenic
1188990212 X:36809720-36809742 AACCTTTGTACACTGTTGGTGGG - Intergenic
1189059093 X:37733449-37733471 AACACTTGTATACTGTTGATAGG - Intronic
1189390648 X:40573628-40573650 AACCCTTGTGCACTGCTGATGGG + Intergenic
1189535635 X:41932660-41932682 AACCCTTGTGCACTGTTGGTGGG + Intergenic
1190373997 X:49771083-49771105 AACCTTTGCACACTGTTGGTGGG - Intergenic
1190530846 X:51374538-51374560 AACCTTTGTACACTGTTGGTGGG + Intergenic
1190854702 X:54282383-54282405 AACCCTTGTACACTGTTGATGGG - Intronic
1190893235 X:54589848-54589870 AACCCTTGCACACTGTTGATGGG - Intergenic
1191703264 X:64065611-64065633 AACATTTATGCACTGTTGATGGG - Intergenic
1191721894 X:64237827-64237849 AACCCTTGTGGATTGTTGATGGG - Intergenic
1192507283 X:71696151-71696173 AACCTTTGTGCACTGTTGGTGGG + Intergenic
1192512580 X:71732380-71732402 AACCTTTGTGCACTGTTGGTGGG - Intergenic
1192514117 X:71749129-71749151 AACCTTTGTGCACTGTTGGTGGG + Intergenic
1192519413 X:71785401-71785423 AACCTTTGTGCACTGTTGGTGGG - Intergenic
1192526823 X:71853634-71853656 AACCTTTGTGCACTGTTGGTGGG + Intergenic
1192617111 X:72637662-72637684 AACTCTTGTGTACTGTGGATGGG - Intronic
1192658498 X:73017951-73017973 AATCATTGTATACTGTTGATGGG - Intergenic
1192838187 X:74825004-74825026 AACCCTTGTATACTGTTGATAGG - Intronic
1192852709 X:74974557-74974579 AACCCTTGTATACTGTGGATGGG - Intergenic
1193106819 X:77685569-77685591 AACCCTTGTATACTGTTGGTAGG + Intronic
1193190530 X:78564796-78564818 AACCTTTGTACACTGTTGGTGGG - Intergenic
1193194436 X:78613977-78613999 AACCCTTGTATACTGTTGGTGGG - Intergenic
1193305022 X:79939054-79939076 AAGCTTTGCGGACTGTTGGTGGG - Intergenic
1193370827 X:80694892-80694914 GACTTTGGGGGACTGTTGATTGG + Intronic
1193662784 X:84277137-84277159 AACCTTTGTGCAGTGGTGATGGG + Intergenic
1193778395 X:85672340-85672362 AACCCTTGTGCACTGTTGGTGGG - Intergenic
1193781768 X:85711727-85711749 AACCCTTGTGCACTGTTGGTGGG - Intergenic
1195072664 X:101295574-101295596 AACCCTTGTATACTGTTGGTAGG + Intergenic
1195097607 X:101519780-101519802 AACCCTTGCACACTGTTGATGGG - Intronic
1195169706 X:102254484-102254506 AACCCTTGTACACTGTTGATGGG - Intergenic
1195189151 X:102432616-102432638 AACCCTTGTACACTGTTGATGGG + Intronic
1195632699 X:107075761-107075783 AACCCTTGTGCACTGTTGATGGG + Intronic
1195874945 X:109530292-109530314 TACCTTTGGGGAGTGTTGACTGG + Intergenic
1195953189 X:110300139-110300161 AACCTTTGTACACTGTTGGTTGG - Intronic
1196049061 X:111285970-111285992 AGCCTTTGGGCACTGTTGGTGGG - Intergenic
1196205912 X:112939214-112939236 AACCCTTGTATACTGTTGGTGGG + Intergenic
1196290298 X:113932725-113932747 AGCCTTTGTGCACTGTGGATAGG - Intergenic
1196705573 X:118714713-118714735 GATCTTTGTGTACTGCTGATGGG - Intergenic
1197044822 X:121982737-121982759 AGCCTTTGCTCACTGTTGATGGG + Intergenic
1197430281 X:126354224-126354246 AATCTTTGTGCACTGTTGATGGG + Intergenic
1197526765 X:127574358-127574380 AACCCTTGTACACTGTTGATGGG - Intergenic
1197862005 X:130980666-130980688 AACCTTTGTACACTGTTGGTGGG + Intergenic
1198037097 X:132812041-132812063 AACCTTTGTGCACTGCTGGTGGG - Intronic
1198124749 X:133631724-133631746 AACCCTTGTGCACTGTTGGTGGG - Intronic
1198313421 X:135442732-135442754 AACTTTTGTGCACTGTTGGTGGG + Intergenic
1198559942 X:137838532-137838554 ACCCCTTGGGGACTGTTGGTTGG + Intergenic
1199478156 X:148269009-148269031 AACCTTTAGGTATTGGTTATTGG + Intergenic
1199599303 X:149532398-149532420 AACCCTTGTGTACTTCTGATGGG - Intronic
1199738305 X:150706345-150706367 AACCTCTGTGTACTGTTGGAGGG - Intronic
1199810464 X:151343838-151343860 AAGATTTGGGAACTGTTGTTGGG - Intergenic
1199915727 X:152338142-152338164 AGCCCTTGGGCACTGTTGAGTGG - Intronic
1200280338 X:154771966-154771988 AACCTTTGTACACTGTTGATGGG - Intronic
1200319489 X:155171938-155171960 AACGTTTGTATACTGTTGGTGGG - Intergenic
1200666174 Y:6027610-6027632 AACCCTTGTATACTGTTGGTGGG + Intergenic
1202298644 Y:23386987-23387009 AACCCTTGTGCACTGCTGATGGG - Intergenic
1202572165 Y:26283612-26283634 AACCCTTGTGCACTGCTGATGGG + Intergenic