ID: 1060431395

View in Genome Browser
Species Human (GRCh38)
Location 9:123553988-123554010
Sequence GCCGAGAGAGGTGGATCACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 55164
Summary {0: 1, 1: 72, 2: 1925, 3: 13051, 4: 40115}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060431395_1060431399 -7 Left 1060431395 9:123553988-123554010 CCTTGTGATCCACCTCTCTCGGC 0: 1
1: 72
2: 1925
3: 13051
4: 40115
Right 1060431399 9:123554004-123554026 TCTCGGCTTCCCAAAGTGCTGGG 0: 257
1: 11765
2: 153950
3: 289823
4: 197900
1060431395_1060431400 1 Left 1060431395 9:123553988-123554010 CCTTGTGATCCACCTCTCTCGGC 0: 1
1: 72
2: 1925
3: 13051
4: 40115
Right 1060431400 9:123554012-123554034 TCCCAAAGTGCTGGGATTATAGG 0: 27231
1: 315676
2: 251783
3: 138973
4: 131031
1060431395_1060431398 -8 Left 1060431395 9:123553988-123554010 CCTTGTGATCCACCTCTCTCGGC 0: 1
1: 72
2: 1925
3: 13051
4: 40115
Right 1060431398 9:123554003-123554025 CTCTCGGCTTCCCAAAGTGCTGG 0: 13
1: 494
2: 13842
3: 156938
4: 286962
1060431395_1060431403 22 Left 1060431395 9:123553988-123554010 CCTTGTGATCCACCTCTCTCGGC 0: 1
1: 72
2: 1925
3: 13051
4: 40115
Right 1060431403 9:123554033-123554055 GGCGTGAGCCAATGAAGAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060431395 Original CRISPR GCCGAGAGAGGTGGATCACA AGG (reversed) Intronic
Too many off-targets to display for this crispr