ID: 1060431396

View in Genome Browser
Species Human (GRCh38)
Location 9:123553997-123554019
Sequence CTTTGGGAAGCCGAGAGAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 225501
Summary {0: 4, 1: 99, 2: 3197, 3: 46694, 4: 175507}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060431396_1060431403 13 Left 1060431396 9:123553997-123554019 CCACCTCTCTCGGCTTCCCAAAG 0: 4
1: 99
2: 3197
3: 46694
4: 175507
Right 1060431403 9:123554033-123554055 GGCGTGAGCCAATGAAGAGCAGG No data
1060431396_1060431400 -8 Left 1060431396 9:123553997-123554019 CCACCTCTCTCGGCTTCCCAAAG 0: 4
1: 99
2: 3197
3: 46694
4: 175507
Right 1060431400 9:123554012-123554034 TCCCAAAGTGCTGGGATTATAGG 0: 27231
1: 315676
2: 251783
3: 138973
4: 131031

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060431396 Original CRISPR CTTTGGGAAGCCGAGAGAGG TGG (reversed) Intronic
Too many off-targets to display for this crispr