ID: 1060431397

View in Genome Browser
Species Human (GRCh38)
Location 9:123554000-123554022
Sequence GCACTTTGGGAAGCCGAGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 475790
Summary {0: 11, 1: 440, 2: 13782, 3: 161594, 4: 299963}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060431397_1060431403 10 Left 1060431397 9:123554000-123554022 CCTCTCTCGGCTTCCCAAAGTGC 0: 11
1: 440
2: 13782
3: 161594
4: 299963
Right 1060431403 9:123554033-123554055 GGCGTGAGCCAATGAAGAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060431397 Original CRISPR GCACTTTGGGAAGCCGAGAG AGG (reversed) Intronic
Too many off-targets to display for this crispr