ID: 1060431399

View in Genome Browser
Species Human (GRCh38)
Location 9:123554004-123554026
Sequence TCTCGGCTTCCCAAAGTGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 653695
Summary {0: 257, 1: 11765, 2: 153950, 3: 289823, 4: 197900}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060431393_1060431399 16 Left 1060431393 9:123553965-123553987 CCAGGATGGTCTCAATCTCTTGA 0: 2898
1: 21891
2: 77774
3: 103141
4: 150613
Right 1060431399 9:123554004-123554026 TCTCGGCTTCCCAAAGTGCTGGG 0: 257
1: 11765
2: 153950
3: 289823
4: 197900
1060431392_1060431399 25 Left 1060431392 9:123553956-123553978 CCACGTTGGCCAGGATGGTCTCA 0: 193
1: 7121
2: 66055
3: 170938
4: 188974
Right 1060431399 9:123554004-123554026 TCTCGGCTTCCCAAAGTGCTGGG 0: 257
1: 11765
2: 153950
3: 289823
4: 197900
1060431395_1060431399 -7 Left 1060431395 9:123553988-123554010 CCTTGTGATCCACCTCTCTCGGC 0: 1
1: 72
2: 1925
3: 13051
4: 40115
Right 1060431399 9:123554004-123554026 TCTCGGCTTCCCAAAGTGCTGGG 0: 257
1: 11765
2: 153950
3: 289823
4: 197900

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060431399 Original CRISPR TCTCGGCTTCCCAAAGTGCT GGG Intronic
Too many off-targets to display for this crispr