ID: 1060431400

View in Genome Browser
Species Human (GRCh38)
Location 9:123554012-123554034
Sequence TCCCAAAGTGCTGGGATTAT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 864694
Summary {0: 27231, 1: 315676, 2: 251783, 3: 138973, 4: 131031}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060431395_1060431400 1 Left 1060431395 9:123553988-123554010 CCTTGTGATCCACCTCTCTCGGC 0: 1
1: 72
2: 1925
3: 13051
4: 40115
Right 1060431400 9:123554012-123554034 TCCCAAAGTGCTGGGATTATAGG 0: 27231
1: 315676
2: 251783
3: 138973
4: 131031
1060431393_1060431400 24 Left 1060431393 9:123553965-123553987 CCAGGATGGTCTCAATCTCTTGA 0: 2898
1: 21891
2: 77774
3: 103141
4: 150613
Right 1060431400 9:123554012-123554034 TCCCAAAGTGCTGGGATTATAGG 0: 27231
1: 315676
2: 251783
3: 138973
4: 131031
1060431396_1060431400 -8 Left 1060431396 9:123553997-123554019 CCACCTCTCTCGGCTTCCCAAAG 0: 4
1: 99
2: 3197
3: 46694
4: 175507
Right 1060431400 9:123554012-123554034 TCCCAAAGTGCTGGGATTATAGG 0: 27231
1: 315676
2: 251783
3: 138973
4: 131031

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060431400 Original CRISPR TCCCAAAGTGCTGGGATTAT AGG Intronic
Too many off-targets to display for this crispr