ID: 1060431401

View in Genome Browser
Species Human (GRCh38)
Location 9:123554013-123554035
Sequence GCCTATAATCCCAGCACTTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 855615
Summary {0: 20277, 1: 245443, 2: 271371, 3: 174555, 4: 143969}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060431401_1060431403 -3 Left 1060431401 9:123554013-123554035 CCCAAAGTGCTGGGATTATAGGC 0: 20277
1: 245443
2: 271371
3: 174555
4: 143969
Right 1060431403 9:123554033-123554055 GGCGTGAGCCAATGAAGAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060431401 Original CRISPR GCCTATAATCCCAGCACTTT GGG (reversed) Intronic
Too many off-targets to display for this crispr