ID: 1060431402

View in Genome Browser
Species Human (GRCh38)
Location 9:123554014-123554036
Sequence CGCCTATAATCCCAGCACTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 807629
Summary {0: 9370, 1: 149078, 2: 285159, 3: 214832, 4: 149190}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060431402_1060431403 -4 Left 1060431402 9:123554014-123554036 CCAAAGTGCTGGGATTATAGGCG 0: 9370
1: 149078
2: 285159
3: 214832
4: 149190
Right 1060431403 9:123554033-123554055 GGCGTGAGCCAATGAAGAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060431402 Original CRISPR CGCCTATAATCCCAGCACTT TGG (reversed) Intronic
Too many off-targets to display for this crispr