ID: 1060431403

View in Genome Browser
Species Human (GRCh38)
Location 9:123554033-123554055
Sequence GGCGTGAGCCAATGAAGAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060431397_1060431403 10 Left 1060431397 9:123554000-123554022 CCTCTCTCGGCTTCCCAAAGTGC 0: 11
1: 440
2: 13782
3: 161594
4: 299963
Right 1060431403 9:123554033-123554055 GGCGTGAGCCAATGAAGAGCAGG No data
1060431395_1060431403 22 Left 1060431395 9:123553988-123554010 CCTTGTGATCCACCTCTCTCGGC 0: 1
1: 72
2: 1925
3: 13051
4: 40115
Right 1060431403 9:123554033-123554055 GGCGTGAGCCAATGAAGAGCAGG No data
1060431401_1060431403 -3 Left 1060431401 9:123554013-123554035 CCCAAAGTGCTGGGATTATAGGC 0: 20277
1: 245443
2: 271371
3: 174555
4: 143969
Right 1060431403 9:123554033-123554055 GGCGTGAGCCAATGAAGAGCAGG No data
1060431396_1060431403 13 Left 1060431396 9:123553997-123554019 CCACCTCTCTCGGCTTCCCAAAG 0: 4
1: 99
2: 3197
3: 46694
4: 175507
Right 1060431403 9:123554033-123554055 GGCGTGAGCCAATGAAGAGCAGG No data
1060431402_1060431403 -4 Left 1060431402 9:123554014-123554036 CCAAAGTGCTGGGATTATAGGCG 0: 9370
1: 149078
2: 285159
3: 214832
4: 149190
Right 1060431403 9:123554033-123554055 GGCGTGAGCCAATGAAGAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060431403 Original CRISPR GGCGTGAGCCAATGAAGAGC AGG Intronic
No off target data available for this crispr