ID: 1060432314

View in Genome Browser
Species Human (GRCh38)
Location 9:123561081-123561103
Sequence GCTTGCACCATTTCAAAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 117
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 104}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060432314_1060432318 7 Left 1060432314 9:123561081-123561103 CCATCCTTTGAAATGGTGCAAGC 0: 1
1: 0
2: 0
3: 12
4: 104
Right 1060432318 9:123561111-123561133 GCTCTCCTTCTGGCTCCTCAAGG No data
1060432314_1060432321 14 Left 1060432314 9:123561081-123561103 CCATCCTTTGAAATGGTGCAAGC 0: 1
1: 0
2: 0
3: 12
4: 104
Right 1060432321 9:123561118-123561140 TTCTGGCTCCTCAAGGGCCTTGG No data
1060432314_1060432322 15 Left 1060432314 9:123561081-123561103 CCATCCTTTGAAATGGTGCAAGC 0: 1
1: 0
2: 0
3: 12
4: 104
Right 1060432322 9:123561119-123561141 TCTGGCTCCTCAAGGGCCTTGGG No data
1060432314_1060432319 8 Left 1060432314 9:123561081-123561103 CCATCCTTTGAAATGGTGCAAGC 0: 1
1: 0
2: 0
3: 12
4: 104
Right 1060432319 9:123561112-123561134 CTCTCCTTCTGGCTCCTCAAGGG No data
1060432314_1060432316 -3 Left 1060432314 9:123561081-123561103 CCATCCTTTGAAATGGTGCAAGC 0: 1
1: 0
2: 0
3: 12
4: 104
Right 1060432316 9:123561101-123561123 AGCCACTGTCGCTCTCCTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060432314 Original CRISPR GCTTGCACCATTTCAAAGGA TGG (reversed) Intronic
901563801 1:10095171-10095193 TCTTGCACCAATTCAAACTATGG - Intronic
902489348 1:16769697-16769719 GTTGGTACCATTTCATAGGAGGG + Intronic
904976878 1:34463404-34463426 GCTTGTTCCAATTCAAGGGAAGG + Intergenic
907569745 1:55472286-55472308 TATTGCATCATTTCCAAGGAAGG - Intergenic
909954221 1:81757808-81757830 GCTTGCGCCCTTTCAAAGACTGG - Intronic
912742116 1:112208538-112208560 GTTTCAACAATTTCAAAGGATGG + Intergenic
915160741 1:153918560-153918582 GCTTGTCTCATTTCAAGGGAGGG - Intronic
916116126 1:161486510-161486532 CCTTGGGCCATTCCAAAGGAAGG - Intergenic
917565120 1:176205983-176206005 TCTTCTTCCATTTCAAAGGATGG - Intronic
918011636 1:180592413-180592435 GCCTGCACCAATTCAAGGGAAGG - Intergenic
921910567 1:220544836-220544858 GCTTTCACAATTTGAAAAGAGGG + Intronic
923531090 1:234812828-234812850 GTTGGTACCATTTCATAGGAGGG - Intergenic
924222371 1:241891194-241891216 GCTTTGCCCATTTCAAAGGTGGG + Intronic
1063810315 10:9697467-9697489 GTTAGCAGCATTTCAAGGGAAGG - Intergenic
1063902312 10:10747152-10747174 GCTTGCAGACTTTTAAAGGATGG - Intergenic
1065925366 10:30430643-30430665 GCTTGCTCCATCTCATAGGTTGG - Intergenic
1067692460 10:48510610-48510632 ACCTCCACCATTTCAAAGGAAGG + Intronic
1068637514 10:59363297-59363319 GCTAGCACCTTTACAAAGGATGG + Intergenic
1071891108 10:90008400-90008422 GCTTACACAATTACAAAGGCTGG + Intergenic
1077704325 11:4469627-4469649 GCTTGCATCATATGAGAGGAGGG + Intergenic
1079394401 11:20049516-20049538 GCTTGCACAATTACAAGGGGAGG - Intronic
1095502722 12:42858266-42858288 GCTTGCACATTGTCAACGGAGGG - Intergenic
1095792013 12:46177997-46178019 GCAAGCACCACTCCAAAGGAAGG + Intergenic
1096530482 12:52239590-52239612 GATCGCAGCATTTCTAAGGAAGG + Intronic
1102234755 12:111287304-111287326 GCTTGCTCCGGTTCCAAGGAGGG - Intronic
1103699010 12:122838439-122838461 GCCTGTACCATTTAAAAAGAGGG + Intronic
1108293205 13:48983598-48983620 GCATGCACCATTGCAGAGGTTGG - Intronic
1112219323 13:97471914-97471936 AGTTGCACCATGTCACAGGATGG + Intergenic
1113678799 13:112227427-112227449 GCTTAAACCATTTCCCAGGAAGG + Intergenic
1117285610 14:54283092-54283114 GCTTGCACCAGCTCCATGGAGGG + Intergenic
1125984737 15:44039007-44039029 GCATCCACCATTGCTAAGGATGG + Intronic
1127694857 15:61435198-61435220 GCTTACACCATTGGAAATGATGG - Intergenic
1128622654 15:69163235-69163257 GCTTTCATCATTTCTAAGTAAGG + Intronic
1131621289 15:94070852-94070874 GTTTCCGCCATTTCAAGGGATGG - Intergenic
1133448029 16:5879124-5879146 GCTTGCACCTTTGCAGAGAAGGG + Intergenic
1133682374 16:8131867-8131889 GCTTTCCCTATTTCAAATGATGG + Intergenic
1137917447 16:52448295-52448317 GCTTGCTCCATTTTAAGCGAGGG - Intronic
1139032609 16:62904253-62904275 GCTTGAAGCCTTTCAGAGGAAGG + Intergenic
1139276915 16:65736284-65736306 GATTCCACCATTTGTAAGGAGGG - Intergenic
1143281540 17:5758267-5758289 GATAGCACTATTTCATAGGACGG + Intergenic
1148698425 17:49574802-49574824 GCTGGGACCACTTCAAATGATGG + Intergenic
1150954756 17:69845062-69845084 GCTTACACAAATTCAAAAGAAGG - Intergenic
1153667925 18:7383012-7383034 CCTTGCCCCATTTCACAGAATGG + Intergenic
1156288435 18:35722281-35722303 GCTTGGACCACCTCAAAGGGAGG + Intergenic
1161227771 19:3155141-3155163 ACTTGCCCCATTGCACAGGAGGG - Intronic
1161410783 19:4116029-4116051 GCTTGCAGACTTTCAAAGGGTGG + Intronic
1163937048 19:20456528-20456550 TCTTGCTCCATTTCCCAGGATGG + Intergenic
1166060117 19:40320781-40320803 GCTGGCACCTTTCCAAATGATGG - Exonic
1166900599 19:46058754-46058776 GCTTGCACCCTTTCAAGCCATGG + Intronic
926337597 2:11875946-11875968 GCCTGAAACATTTCAGAGGATGG - Intergenic
930623654 2:53670989-53671011 GCTTCCACCATTTCTAAAGTTGG - Intronic
931643397 2:64400884-64400906 CCTTGGACCATTTCAAAGACTGG - Intergenic
931906367 2:66847726-66847748 CCTTGCATCATTTTAAAGAAAGG - Intergenic
938725585 2:134106054-134106076 GCTTGCACGACATCAAAGGATGG - Intergenic
939067057 2:137496120-137496142 ACTTGCAGAATTTCAAAGGATGG - Intronic
941398293 2:164998571-164998593 ACTTGCATCTTTTCAAATGATGG + Intergenic
942914853 2:181293549-181293571 TCTTGAAGAATTTCAAAGGAAGG + Intergenic
946865971 2:224040935-224040957 GCTGGGAACAATTCAAAGGAGGG + Intergenic
947154259 2:227145569-227145591 GGTCACACCATTCCAAAGGATGG + Intronic
947680086 2:232022743-232022765 GCAGGCACCATGTCAAATGACGG - Intronic
1170723302 20:18903235-18903257 GCTTGGACCTTTTCAAATGGCGG + Intergenic
1174884212 20:54314301-54314323 GATTGCAGTATTTCAAAAGATGG - Intergenic
1176262449 20:64189278-64189300 AACTGCAGCATTTCAAAGGAAGG - Intronic
1180577477 22:16792825-16792847 GGTTGCAACATGTAAAAGGAAGG - Intronic
1182897507 22:33870865-33870887 GCCTGTCCCATTTTAAAGGAGGG + Intronic
1183770590 22:39922324-39922346 ATTTGCACCATATTAAAGGATGG + Intronic
949507339 3:4740074-4740096 GCCAGCCCCATTTCAAAGGCGGG + Intronic
950859409 3:16134456-16134478 TATTGCACCATTTCAAAGGGAGG + Intergenic
954603882 3:51894068-51894090 GCTGGCAGCATTTCACAGGGAGG + Intergenic
954885743 3:53871677-53871699 GCTTTGACCATTCCAAAGCAAGG + Intronic
955489351 3:59466686-59466708 CCTATCCCCATTTCAAAGGAAGG + Intergenic
957429667 3:80085815-80085837 GCTTGCACCATGCCATAGAAAGG - Intergenic
959916517 3:111822553-111822575 GCTTGCCCCATCTTAAAGGATGG + Intronic
963368437 3:144367681-144367703 GCTTGCACCATCTGAAATGATGG + Intergenic
964042624 3:152280744-152280766 ACTTTCACCATTTCAAAGTCTGG - Intronic
966851508 3:184167796-184167818 GCTGGCTCCAGATCAAAGGAAGG - Intronic
967308363 3:188081941-188081963 CCTTTCACCATTACAAAGGTAGG - Intergenic
970222511 4:13825325-13825347 GCTTGCACCCTTTGAAACCACGG - Intergenic
972084765 4:35201700-35201722 GGCTGAACAATTTCAAAGGAGGG - Intergenic
977019426 4:91741166-91741188 GCTTTCAACTCTTCAAAGGACGG - Intergenic
978416096 4:108477631-108477653 GCTTGCACAACCTCACAGGATGG + Intergenic
981081085 4:140640210-140640232 GCTTGCACTTTTTCCAGGGAAGG + Intronic
982229965 4:153199633-153199655 GCTTGCACCCTTTCTATGGAAGG - Intronic
982891032 4:160850329-160850351 GCTTAAACTATTTCATAGGAAGG + Intergenic
987199644 5:15562978-15563000 GCTTTCAACATTAGAAAGGATGG + Intronic
987254674 5:16138309-16138331 GCTTGCACCATTTGAAGCAATGG - Intronic
988252976 5:28784248-28784270 GCATGCACCATAGCAAATGAAGG - Intergenic
991194749 5:63919908-63919930 GCTTGCTGCATTTCAAAAGGGGG - Intergenic
995933685 5:117483164-117483186 GCTTGCACCAGTGCATAGTAGGG - Intergenic
1000293252 5:159890787-159890809 ACTTGCCCCATTTCAAGGGAAGG + Intergenic
1004132834 6:12937274-12937296 ACTGCCACCATCTCAAAGGAAGG + Intronic
1009723485 6:67506425-67506447 GCTTGCACCATTTGAAGCAATGG + Intergenic
1011522326 6:88222303-88222325 GATTGCTCCATTTTACAGGATGG - Intergenic
1014406986 6:121064634-121064656 GCTTGCACCATTTGAAACCATGG - Intergenic
1015574931 6:134661016-134661038 GCGTGAACCATTTCAAAGGCTGG + Intergenic
1026668391 7:72364470-72364492 GCTTCCTACATTTCAAAGGGAGG - Intronic
1040696934 8:50011097-50011119 GCTTGTGTCATTTCAAAGCAGGG - Intronic
1043805609 8:84669092-84669114 TATTACACCATTTCAAAGGGTGG - Intronic
1043933939 8:86121559-86121581 GACTCCACCATTTCAAAAGAAGG + Intronic
1044520743 8:93196369-93196391 TCATGCACAATTTCCAAGGAAGG + Intergenic
1045156269 8:99476380-99476402 GCTTTCAAAATTCCAAAGGATGG + Intronic
1046277338 8:111981113-111981135 GCTTGGGACATTTCCAAGGAAGG + Intergenic
1046297306 8:112237287-112237309 GCTCTTACAATTTCAAAGGAAGG - Exonic
1046915892 8:119678034-119678056 GCTAGCACCACTTGAAAGGTTGG - Intergenic
1047558582 8:125961582-125961604 GTTTGCACATTTTGAAAGGAGGG + Intergenic
1049574663 8:143384631-143384653 GCTTCCTCCACTTCACAGGACGG - Intergenic
1052785808 9:32827238-32827260 ACTTGCACCTTTTCCAAAGATGG - Intergenic
1053452904 9:38208290-38208312 GCTTGCACCAGTGCATAAGAAGG - Intergenic
1054323147 9:63693342-63693364 GCTTGCAGTATTTCAAAATATGG - Intergenic
1055792962 9:79943360-79943382 GCTGGAACCATCTCAAAGAATGG - Intergenic
1055954848 9:81763899-81763921 ACTTACACCATGTAAAAGGATGG + Intergenic
1060432314 9:123561081-123561103 GCTTGCACCATTTCAAAGGATGG - Intronic
1062228940 9:135470430-135470452 GCCTGCACGATTTCCAAAGAGGG - Intergenic
1188809922 X:34640820-34640842 GCTTCCACAATTTCGTAGGAGGG - Intronic
1190281249 X:48931953-48931975 GGTTTCACCATGTCAAAGGCTGG - Intronic
1192465907 X:71355743-71355765 GCTGATACCATTTCAAAGAATGG + Intergenic
1199505587 X:148557886-148557908 ATTGGCACCATTTGAAAGGATGG - Intronic