ID: 1060434536

View in Genome Browser
Species Human (GRCh38)
Location 9:123582246-123582268
Sequence CGCTGCCACCTCTAGAGATC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 89
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 78}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060434536_1060434543 27 Left 1060434536 9:123582246-123582268 CCTGATCTCTAGAGGTGGCAGCG 0: 1
1: 0
2: 0
3: 10
4: 78
Right 1060434543 9:123582296-123582318 GACTCCCACAGGAAGAGGAGAGG No data
1060434536_1060434541 16 Left 1060434536 9:123582246-123582268 CCTGATCTCTAGAGGTGGCAGCG 0: 1
1: 0
2: 0
3: 10
4: 78
Right 1060434541 9:123582285-123582307 CGAGACTCTCAGACTCCCACAGG No data
1060434536_1060434542 22 Left 1060434536 9:123582246-123582268 CCTGATCTCTAGAGGTGGCAGCG 0: 1
1: 0
2: 0
3: 10
4: 78
Right 1060434542 9:123582291-123582313 TCTCAGACTCCCACAGGAAGAGG No data
1060434536_1060434540 -7 Left 1060434536 9:123582246-123582268 CCTGATCTCTAGAGGTGGCAGCG 0: 1
1: 0
2: 0
3: 10
4: 78
Right 1060434540 9:123582262-123582284 GGCAGCGTGCTGGGGAGAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060434536 Original CRISPR CGCTGCCACCTCTAGAGATC AGG (reversed) Intronic
903473233 1:23601941-23601963 GTCTACCCCCTCTAGAGATCAGG + Intronic
905015737 1:34777243-34777265 CCCTGCCACCCCTAGAGAGCAGG + Intronic
911502512 1:98705825-98705847 CACTGCCACCTCTTCAGTTCAGG - Intronic
916296531 1:163226362-163226384 AGCTACCACCTCTAGAGTTGGGG + Intronic
916890736 1:169109881-169109903 CGCTGTGACGTCAAGAGATCTGG - Intronic
921207175 1:212858623-212858645 CGCTGCCGCCTCGGGAGTTCTGG + Exonic
922975108 1:229777873-229777895 TTCTGCCACCTCTAAATATCAGG - Intergenic
1064791448 10:18960990-18961012 CTCTGCCACCTCTGGGGACCCGG + Intergenic
1066477299 10:35760400-35760422 CAGTGCTAACTCTAGAGATCAGG - Intergenic
1071229914 10:83573579-83573601 CCCTAGCATCTCTAGAGATCAGG + Intergenic
1072566192 10:96618754-96618776 GGCTGCCAGCTCTAGAGCCCTGG + Intronic
1074211381 10:111338429-111338451 TGCTGCCACCTCTAGGTACCAGG + Intergenic
1081738183 11:45419805-45419827 AGCTGCCACCCCAAGAGATGGGG + Intergenic
1085458328 11:76678297-76678319 AGCTTCCACCTTTAGAAATCAGG - Intergenic
1087959930 11:104335654-104335676 TGCTGCCACCTCTACACTTCTGG - Intergenic
1087996240 11:104812767-104812789 CGCTGTCACTTCTATTGATCTGG + Intergenic
1089112995 11:116071850-116071872 GGTTGCCACCTCTAGGTATCAGG - Intergenic
1090175838 11:124648779-124648801 CCCTTCCACCCCCAGAGATCTGG + Intronic
1092137349 12:6159289-6159311 CGCTGTCACCTCTCAATATCAGG - Intergenic
1095363640 12:41374701-41374723 GGCTACCATCTCTAGAGCTCAGG + Intronic
1095709185 12:45269976-45269998 TGAGGCCACCTCCAGAGATCTGG + Intronic
1098931683 12:76424074-76424096 CGCTGCCACCTCTACCTCTCGGG + Intronic
1102437509 12:112936794-112936816 TCCTGCCACCTCTAGAGGCCTGG + Intergenic
1103955303 12:124573078-124573100 CGCTGCCACCTCAAGAGCCCTGG + Intergenic
1106876684 13:34082180-34082202 AGGTGGCCCCTCTAGAGATCAGG - Intergenic
1110190776 13:72727196-72727218 CGCTGTCACCGCAGGAGATCGGG + Intronic
1119703017 14:76768097-76768119 GGCTGCCACCTGCAGAGATCAGG + Intronic
1121415833 14:93778879-93778901 AGCTGCCCCCTTTAAAGATCTGG + Intronic
1125960280 15:43824380-43824402 CCCCGCCAGCTCTTGAGATCTGG - Intronic
1131302769 15:91214138-91214160 AGCTCCCTCCTCTAGAGATCCGG - Intronic
1134234439 16:12454459-12454481 CTATGTCACCTCTAGAGTTCTGG - Intronic
1136176681 16:28521950-28521972 ATCTGCCACCTCTCGAGATCTGG + Intergenic
1140739270 16:77926745-77926767 CACTGCCCCCTCTAGAACTCTGG + Intronic
1141164561 16:81651825-81651847 CTCTGCCAACTCTAGAGCCCTGG + Intronic
1144219498 17:13087195-13087217 CAGAGCCACCTCTAGAGATGGGG - Intergenic
1146822038 17:35991324-35991346 GGCTCCCACCCCTAGAAATCTGG - Intronic
1147627408 17:41909061-41909083 CCCTCCCACCTCTAGAATTCTGG - Exonic
1149124042 17:53206384-53206406 GGATGCCAGATCTAGAGATCTGG - Intergenic
1149546963 17:57510935-57510957 CCCTCCCACCTCCAGAGAGCGGG - Intronic
1151716532 17:75834019-75834041 CCCTGCCAGCTCTGTAGATCTGG - Intronic
1153085063 18:1275966-1275988 AGCTGCTACCTCTAGGGATGAGG - Intergenic
1153415398 18:4840761-4840783 CACTGCCAACTATAGAGATTTGG - Intergenic
1161489832 19:4555826-4555848 CGCTGACTCCTCTTGAGCTCAGG + Intronic
1163052320 19:14693667-14693689 CCATGCCACCTCTAGAGGTCAGG - Intronic
1166100730 19:40570180-40570202 CACCCCCACCTCCAGAGATCTGG + Intronic
1167040797 19:47021471-47021493 TGCTCCCACCTCCAGAGATGTGG + Intronic
1168251978 19:55146697-55146719 CGCAGCCTCCTCTGGAGATGGGG + Exonic
1168306904 19:55440758-55440780 CTCTGCCACCTTTAGAGCTCTGG - Exonic
1168314598 19:55479120-55479142 CGCTCCCACATCTAGAGGTCAGG + Intronic
925487260 2:4349167-4349189 CACTGCCATCTCTAGGGATCAGG + Intergenic
931694690 2:64862945-64862967 CACTCCAACCTTTAGAGATCTGG - Intergenic
934560161 2:95309057-95309079 CACTGCCACAGCTAGAGGTCAGG + Intronic
944850667 2:203715880-203715902 AGCTGCCACCTCCACAGCTCAGG + Intronic
945198660 2:207260446-207260468 CACTGCCACCTCATGGGATCTGG - Intergenic
948204480 2:236156059-236156081 CACAGCCACCTCGAGAGCTCTGG + Intergenic
1172609989 20:36243440-36243462 CTGTGCCACCTCCAGAGACCTGG - Intronic
1173856504 20:46253595-46253617 TGCTGCCACCTCCAGGGATCCGG + Intronic
1175738418 20:61403466-61403488 CGGTCCCCTCTCTAGAGATCCGG + Intronic
1180882430 22:19215503-19215525 CGCTCCCACCTCTATAGTGCTGG + Intronic
954697170 3:52434004-52434026 CCCTGGCACCTCCAGAGAACTGG - Exonic
963907836 3:150787943-150787965 CGGTGCCACCACTAGGGGTCAGG + Intergenic
972063038 4:34905178-34905200 CACTGCCACCTCAAGATGTCAGG + Intergenic
973127773 4:46609536-46609558 CTCTCCCACCTCTAGAGTTGGGG + Intergenic
998158804 5:139801536-139801558 CCCTCCCACCTCTTGATATCAGG + Intronic
998938714 5:147257589-147257611 CGCTGCCCCCTCCAGAGTTGTGG - Intronic
1001314300 5:170631793-170631815 TGCTGCCCCCACTAGAGACCTGG + Intronic
1002179869 5:177425932-177425954 CGCTACCACCCCTAGACCTCGGG - Intronic
1018730989 6:166650369-166650391 CCCTCCCACCTCTAGACAGCTGG - Intronic
1022507468 7:30915853-30915875 TGCTGCCTCCTCCAGAGCTCAGG + Intronic
1023799458 7:43821375-43821397 CGCTGCCCCCTCCAGAGTTGTGG + Intergenic
1029668057 7:102008568-102008590 CTCTGCCCTCTCTAGAGATTGGG + Intronic
1030473953 7:110003997-110004019 CACTGCCACCTATAGAAATAAGG - Intergenic
1036670872 8:10786631-10786653 CTCTGCCCCCTCCAAAGATCTGG + Intronic
1039404188 8:37298660-37298682 TGCTGCCACCTCTGCAGAGCTGG + Intergenic
1039458814 8:37726760-37726782 CACTGCCACAGCTAGAGATGGGG + Intergenic
1046646567 8:116792254-116792276 CGCTGCCAGCTCTTGAGAGATGG + Intronic
1060298043 9:122356289-122356311 CCCTTCCACCTCTTGGGATCAGG - Intergenic
1060341526 9:122781520-122781542 AGCTGTCCCCTCTAGAGAGCAGG + Intergenic
1060434536 9:123582246-123582268 CGCTGCCACCTCTAGAGATCAGG - Intronic
1061001702 9:127906325-127906347 AGCTGCCAGCTCCAGGGATCAGG - Intergenic
1062160210 9:135075710-135075732 CGCTGCCACCTCCAACGACCTGG - Intronic
1191191698 X:57675011-57675033 CTGTGCCACATGTAGAGATCAGG + Intergenic
1192263577 X:69523711-69523733 CGCTGCCATCTCAAGGGTTCAGG + Intronic
1192502488 X:71663115-71663137 AGCTGCCACCTTTGGAGCTCCGG - Intergenic
1192509691 X:71714491-71714513 AGCTGCCACCTTTGGAGCTCCGG - Exonic
1192517006 X:71767062-71767084 AGCTGCCACCTTTGGAGCTCCGG + Exonic
1194924909 X:99813262-99813284 CTCTGCCAACTATAGAGGTCAGG + Intergenic
1199480682 X:148295569-148295591 AGCTGCTTCCTCTAGAGAACAGG + Intergenic
1199590807 X:149467010-149467032 TGCTTCCACCTATAAAGATCAGG + Intergenic