ID: 1060443107

View in Genome Browser
Species Human (GRCh38)
Location 9:123660156-123660178
Sequence CTGGGCTCCCTGTCTAAAAC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060443102_1060443107 -3 Left 1060443102 9:123660136-123660158 CCACCTCAGCTCTGTGAGCTCTG 0: 1
1: 0
2: 3
3: 43
4: 442
Right 1060443107 9:123660156-123660178 CTGGGCTCCCTGTCTAAAACGGG No data
1060443105_1060443107 -6 Left 1060443105 9:123660139-123660161 CCTCAGCTCTGTGAGCTCTGGGC 0: 1
1: 0
2: 4
3: 47
4: 407
Right 1060443107 9:123660156-123660178 CTGGGCTCCCTGTCTAAAACGGG No data
1060443101_1060443107 2 Left 1060443101 9:123660131-123660153 CCTTGCCACCTCAGCTCTGTGAG 0: 1
1: 0
2: 3
3: 38
4: 447
Right 1060443107 9:123660156-123660178 CTGGGCTCCCTGTCTAAAACGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060443107 Original CRISPR CTGGGCTCCCTGTCTAAAAC GGG Intronic
No off target data available for this crispr