ID: 1060445144

View in Genome Browser
Species Human (GRCh38)
Location 9:123680813-123680835
Sequence CAAAGCTATGAGATGGGACC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060445140_1060445144 4 Left 1060445140 9:123680786-123680808 CCGACACCTCTTTCTACTAGTTC 0: 1
1: 0
2: 0
3: 18
4: 207
Right 1060445144 9:123680813-123680835 CAAAGCTATGAGATGGGACCAGG No data
1060445141_1060445144 -2 Left 1060445141 9:123680792-123680814 CCTCTTTCTACTAGTTCAGTTCA 0: 1
1: 0
2: 2
3: 11
4: 163
Right 1060445144 9:123680813-123680835 CAAAGCTATGAGATGGGACCAGG No data
1060445139_1060445144 28 Left 1060445139 9:123680762-123680784 CCATTAAAAAATTTTAAGAGCTC 0: 1
1: 0
2: 3
3: 51
4: 493
Right 1060445144 9:123680813-123680835 CAAAGCTATGAGATGGGACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060445144 Original CRISPR CAAAGCTATGAGATGGGACC AGG Intronic
No off target data available for this crispr